Mutagenetix > Incidental Mutation

Incidental Mutation 'R2005:Abcb5'

225408

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

040014-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R2005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118877827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 961 (A961V)

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably benign
Transcript: ENSMUST00000035515
AA Change: A961V

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: A961V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	G	1: 165,525,022	Y475C	probably benign	Het
Adgrb3	T	C	1: 25,111,718	M1145V	probably benign	Het
Akr1c21	A	G	13: 4,574,215	T23A	probably damaging	Het
Ankrd33b	A	T	15: 31,297,668	S314R	probably damaging	Het
Apc	T	C	18: 34,310,909		probably null	Het
Atg9a	T	A	1: 75,185,991	Q460L	probably benign	Het
Birc3	C	T	9: 7,860,341	C292Y	probably damaging	Het
Capn5	T	C	7: 98,129,363	I350V	probably benign	Het
Cc2d2a	G	A	5: 43,726,373		probably null	Het
Cdh22	T	A	2: 165,180,923	E76V	probably damaging	Het
Cdh8	T	C	8: 99,033,471		probably null	Het
Cdkn1b	ATTCTTCTTC	ATTCTTCTTCTTC	6: 134,921,956		probably benign	Het
Cfap54	T	A	10: 92,884,768	D2608V	unknown	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Cwf19l2	A	T	9: 3,430,720	N351Y	possibly damaging	Het
Cyp2c67	A	T	19: 39,643,345	M136K	probably damaging	Het
Ddx10	A	G	9: 53,240,475		probably null	Het
Ddx47	A	G	6: 135,018,121	N92S	probably benign	Het
Ddx50	T	A	10: 62,640,464	H306L	probably benign	Het
Dnajc27	A	G	12: 4,097,317	T167A	possibly damaging	Het
Dscam	T	G	16: 97,038,920	K162N	probably benign	Het
Eif4h	G	A	5: 134,627,677	T53I	probably benign	Het
Elmo2	T	C	2: 165,298,279	N332S	probably benign	Het
Ergic3	A	G	2: 156,011,108	N157S	possibly damaging	Het
F2rl1	G	T	13: 95,513,274	R367S	probably damaging	Het
Fbxo36	G	A	1: 84,900,069	A151T	probably benign	Het
Foxf2	G	T	13: 31,626,141	R21L	unknown	Het
Gmip	T	A	8: 69,814,043	H269Q	probably benign	Het
Gng4	T	A	13: 13,806,166	V32E	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Helz2	C	T	2: 181,231,329	R2396H	probably benign	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Itgb3bp	A	C	4: 99,814,058	N16K	probably benign	Het
Kcnt2	A	G	1: 140,553,018	M824V	probably damaging	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mmp25	G	A	17: 23,640,242	R144W	probably damaging	Het
Mmrn1	A	T	6: 60,976,084	I450F	possibly damaging	Het
Mroh2b	A	T	15: 4,917,158	K480M	probably damaging	Het
Nbn	T	A	4: 15,979,351	D445E	probably benign	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Olfr1118	T	A	2: 87,309,448	S240T	probably benign	Het
Olfr1166	A	G	2: 88,124,547	L146P	probably damaging	Het
Olfr378	A	T	11: 73,425,239	V248E	probably damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Pard3b	A	T	1: 62,144,891	E183D	probably benign	Het
Pde10a	G	A	17: 8,929,091		probably null	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Prdm13	T	C	4: 21,685,695		probably benign	Het
Rc3h2	T	A	2: 37,389,753	K461*	probably null	Het
Reep2	C	T	18: 34,845,621	T117M	probably damaging	Het
Rhbdd1	A	G	1: 82,340,810	N138S	probably benign	Het
Rnf19a	A	T	15: 36,241,770	F708I	possibly damaging	Het
Robo2	G	A	16: 73,933,115	H1069Y	possibly damaging	Het
Rpl9	C	T	5: 65,389,535	V112I	probably benign	Het
Sec16a	A	C	2: 26,439,080	S974R	probably benign	Het
Sfrp5	A	G	19: 42,198,836	M265T	probably benign	Het
Skint7	T	C	4: 111,984,850	I305T	probably benign	Het
Slc6a7	T	C	18: 61,001,641	D454G	possibly damaging	Het
Slco6c1	A	G	1: 97,081,489	I407T	probably damaging	Het
Slfn8	A	T	11: 83,004,150	M610K	probably damaging	Het
Spidr	A	G	16: 16,048,049	S299P	probably damaging	Het
Sptbn4	C	T	7: 27,366,419	W2034*	probably null	Het
Stard9	T	A	2: 120,664,945	F100L	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stc1	T	C	14: 69,031,647		probably null	Het
Sun2	T	C	15: 79,726,624	E667G	possibly damaging	Het
Tacc2	T	C	7: 130,731,550	S511P	probably damaging	Het
Tasp1	T	G	2: 139,977,678	K202Q	probably damaging	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tgds	A	G	14: 118,130,656	V35A	possibly damaging	Het
Tubgcp6	G	A	15: 89,104,166	T860I	probably benign	Het
Twf1	C	T	15: 94,585,447		probably null	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn2r117	A	G	17: 23,477,644	I263T	probably damaging	Het
Washc5	A	G	15: 59,341,155	L892P	possibly damaging	Het
Wnk4	T	C	11: 101,263,890	C302R	probably damaging	Het
Zfp395	A	G	14: 65,388,885	E191G	possibly damaging	Het
Zkscan17	A	G	11: 59,492,216	L302P	probably damaging	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1678:Abcb5	UTSW	12	118965329	start gained	probably benign
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTACTCTTCCTTGAGGTGC -3'
(R):5'- GGGCTAACTCCAAGGTTGTTTG -3'

Sequencing Primer
(F):5'- GGCACCTGATCTGAGCAGAATATTC -3'
(R):5'- TGGCTGTAGAGAGCACCTG -3'

Posted On

2014-08-25