Incidental Mutation 'R2039:Cuzd1'
ID225423
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene NameCUB and zona pellucida-like domains 1
SynonymsERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131308554-131322292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131309616 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 545 (S545G)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably benign
Transcript: ENSMUST00000046611
AA Change: S545G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: S545G

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208422
Predicted Effect probably benign
Transcript: ENSMUST00000208921
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 131316136 missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 131311794 missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 131314885 missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 131320103 missense probably benign 0.01
PIT4504001:Cuzd1 UTSW 7 131309800 missense possibly damaging 0.88
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 131316262 missense probably benign 0.16
R0375:Cuzd1 UTSW 7 131311908 intron probably benign
R0446:Cuzd1 UTSW 7 131316280 splice site probably null
R0482:Cuzd1 UTSW 7 131309872 unclassified probably benign
R0765:Cuzd1 UTSW 7 131316095 missense probably benign 0.40
R0932:Cuzd1 UTSW 7 131320194 intron probably benign
R1463:Cuzd1 UTSW 7 131316642 missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 131311703 missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 131311644 missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 131309696 missense probably benign 0.00
R2027:Cuzd1 UTSW 7 131320091 missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 131314914 intron probably benign
R2857:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 131318054 missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 131316621 missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 131311523 missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 131316074 missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 131316124 missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 131309768 missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 131311757 missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 131311683 missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 131316665 missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 131309731 missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 131308851 missense probably benign 0.22
R7524:Cuzd1 UTSW 7 131311618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGTGTGCTATCCATGTATATGC -3'
(R):5'- CTTATTTGGGCACTATGGAAGGTTC -3'

Sequencing Primer
(F):5'- CCGTACATCTCAGGAACA -3'
(R):5'- GGTTCCAGTTTAATGCCTTTAAATTC -3'
Posted On2014-08-25