Incidental Mutation 'R2005:Tgds'
ID 225426
Institutional Source Beutler Lab
Gene Symbol Tgds
Ensembl Gene ENSMUSG00000022130
Gene Name TDP-glucose 4,6-dehydratase
Synonyms 2610017J16Rik, 2610025M23Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.504) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 118349323-118370167 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118368068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000022727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022727] [ENSMUST00000227350] [ENSMUST00000228543]
AlphaFold Q8VDR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000022727
AA Change: V35A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022727
Gene: ENSMUSG00000022130
AA Change: V35A

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 18 333 2.9e-27 PFAM
Pfam:Epimerase 20 258 3.2e-61 PFAM
Pfam:Polysacc_synt_2 20 300 2.6e-27 PFAM
Pfam:3Beta_HSD 21 248 3.2e-29 PFAM
Pfam:GDP_Man_Dehyd 21 327 2.3e-77 PFAM
Pfam:NAD_binding_4 22 230 9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227350
AA Change: V35A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228085
Predicted Effect probably benign
Transcript: ENSMUST00000228543
AA Change: V35A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the short-chain dehydrogenases/reductases (SDR) superfamily, and is thought to contain a nicotinamide adenine dinucleotide (NAD) binding domain. This large SDR family of enzymes is involved in the metabolism of a variety of compounds, including prostaglandins, retinoids, lipids, steroid hormones, and xenobiotics. Mutations in this gene have been associated with Catel-Manzke syndrome, which is characterized by Pierre Robin sequence, and radial deviation of the index finger due to the presence of an accessory bone between the index finger and its proximal phalanx. Pierre Robin sequence is defined by an undersized jaw, backwards displacement of the tongue base that causes an obstruction of the airways, and can also be associated with a cleft palate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Tgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Tgds APN 14 118,365,626 (GRCm39) splice site probably benign
IGL01521:Tgds APN 14 118,350,506 (GRCm39) missense probably damaging 1.00
IGL01928:Tgds APN 14 118,353,541 (GRCm39) missense probably benign 0.04
IGL02134:Tgds APN 14 118,350,534 (GRCm39) missense probably benign 0.03
IGL03353:Tgds APN 14 118,364,919 (GRCm39) nonsense probably null
R0079:Tgds UTSW 14 118,353,647 (GRCm39) missense possibly damaging 0.76
R2104:Tgds UTSW 14 118,359,149 (GRCm39) nonsense probably null
R4676:Tgds UTSW 14 118,353,643 (GRCm39) missense probably benign 0.01
R4801:Tgds UTSW 14 118,354,445 (GRCm39) intron probably benign
R4992:Tgds UTSW 14 118,355,175 (GRCm39) missense probably damaging 1.00
R5051:Tgds UTSW 14 118,365,639 (GRCm39) missense probably damaging 1.00
R5083:Tgds UTSW 14 118,353,491 (GRCm39) splice site probably null
R5802:Tgds UTSW 14 118,370,119 (GRCm39) missense probably benign 0.00
R9478:Tgds UTSW 14 118,352,544 (GRCm39) missense possibly damaging 0.94
R9786:Tgds UTSW 14 118,368,049 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGCAGACCCTGAGAGG -3'
(R):5'- CAGGCAGTTTTATGTGGCACAG -3'

Sequencing Primer
(F):5'- TGAGAGGCTGGGACGACC -3'
(R):5'- TTTTATGTGGCACAGGGAAGATAC -3'
Posted On 2014-08-25