Incidental Mutation 'R2005:Rnf19a'
ID 225432
Institutional Source Beutler Lab
Gene Symbol Rnf19a
Ensembl Gene ENSMUSG00000022280
Gene Name ring finger protein 19A
Synonyms XY body protein, Rnf19, Dorfin, XYbp
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.595) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 36240080-36283293 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36241916 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 708 (F708I)
Ref Sequence ENSEMBL: ENSMUSP00000022890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]
AlphaFold P50636
Predicted Effect possibly damaging
Transcript: ENSMUST00000022890
AA Change: F708I

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: F708I

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
RING 132 179 5.56e-3 SMART
IBR 199 264 1.5e-24 SMART
IBR 283 347 1.87e-2 SMART
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185150
Predicted Effect probably benign
Transcript: ENSMUST00000228358
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Rnf19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf19a APN 15 36,265,948 (GRCm39) missense probably damaging 0.98
Cycle UTSW 15 36,253,450 (GRCm39) intron probably benign
Tolkien UTSW 15 36,265,452 (GRCm39) missense possibly damaging 0.80
Wagner UTSW 15 36,244,342 (GRCm39) missense probably benign 0.05
R0245:Rnf19a UTSW 15 36,253,178 (GRCm39) missense probably damaging 1.00
R0583:Rnf19a UTSW 15 36,253,151 (GRCm39) missense probably damaging 1.00
R1295:Rnf19a UTSW 15 36,244,247 (GRCm39) nonsense probably null
R1528:Rnf19a UTSW 15 36,265,801 (GRCm39) missense possibly damaging 0.75
R1710:Rnf19a UTSW 15 36,244,353 (GRCm39) missense probably damaging 1.00
R1835:Rnf19a UTSW 15 36,266,071 (GRCm39) missense probably benign
R2110:Rnf19a UTSW 15 36,254,665 (GRCm39) missense possibly damaging 0.79
R3118:Rnf19a UTSW 15 36,242,045 (GRCm39) nonsense probably null
R3776:Rnf19a UTSW 15 36,266,058 (GRCm39) missense probably benign 0.03
R4005:Rnf19a UTSW 15 36,245,774 (GRCm39) missense probably damaging 0.98
R5184:Rnf19a UTSW 15 36,244,342 (GRCm39) missense probably benign 0.05
R5297:Rnf19a UTSW 15 36,247,924 (GRCm39) missense probably damaging 1.00
R5386:Rnf19a UTSW 15 36,242,185 (GRCm39) missense probably benign 0.01
R5647:Rnf19a UTSW 15 36,266,109 (GRCm39) start gained probably benign
R6451:Rnf19a UTSW 15 36,253,205 (GRCm39) missense possibly damaging 0.64
R7003:Rnf19a UTSW 15 36,254,650 (GRCm39) nonsense probably null
R7304:Rnf19a UTSW 15 36,254,598 (GRCm39) missense probably damaging 0.98
R7893:Rnf19a UTSW 15 36,241,814 (GRCm39) missense possibly damaging 0.95
R8808:Rnf19a UTSW 15 36,242,021 (GRCm39) missense probably benign 0.00
R8864:Rnf19a UTSW 15 36,265,452 (GRCm39) missense possibly damaging 0.80
R8940:Rnf19a UTSW 15 36,260,284 (GRCm39) missense probably damaging 1.00
R9063:Rnf19a UTSW 15 36,265,615 (GRCm39) nonsense probably null
R9093:Rnf19a UTSW 15 36,253,450 (GRCm39) intron probably benign
R9135:Rnf19a UTSW 15 36,253,310 (GRCm39) critical splice acceptor site probably null
R9525:Rnf19a UTSW 15 36,247,375 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGGTCGTTTTCTACCTCAGG -3'
(R):5'- TCCGACACAACAGTGGAAGC -3'

Sequencing Primer
(F):5'- CCTCAGGAAGGGTGTTCACAG -3'
(R):5'- TGGATGACAGTGGTGCTACCC -3'
Posted On 2014-08-25