Incidental Mutation 'R2005:Rnf19a'
ID 225432
Institutional Source Beutler Lab
Gene Symbol Rnf19a
Ensembl Gene ENSMUSG00000022280
Gene Name ring finger protein 19A
Synonyms XY body protein, Dorfin, Rnf19, XYbp
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 36239933-36283147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36241770 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 708 (F708I)
Ref Sequence ENSEMBL: ENSMUSP00000022890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022890] [ENSMUST00000228358]
AlphaFold P50636
Predicted Effect possibly damaging
Transcript: ENSMUST00000022890
AA Change: F708I

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022890
Gene: ENSMUSG00000022280
AA Change: F708I

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
RING 132 179 5.56e-3 SMART
IBR 199 264 1.5e-24 SMART
IBR 283 347 1.87e-2 SMART
transmembrane domain 373 395 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 775 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185150
Predicted Effect probably benign
Transcript: ENSMUST00000228358
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ring between ring fingers (RBR) protein family, and the encoded protein contains two RING-finger motifs and an in between RING fingers motif. This protein is an E3 ubiquitin ligase that is localized to Lewy bodies, and ubiquitylates synphilin-1, which is an interacting protein of alpha synuclein in neurons. The encoded protein may be involved in amyotrophic lateral sclerosis and Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Rnf19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf19a APN 15 36265802 missense probably damaging 0.98
Cycle UTSW 15 36253304 intron probably benign
Tolkien UTSW 15 36265306 missense possibly damaging 0.80
Wagner UTSW 15 36244196 missense probably benign 0.05
R0245:Rnf19a UTSW 15 36253032 missense probably damaging 1.00
R0583:Rnf19a UTSW 15 36253005 missense probably damaging 1.00
R1295:Rnf19a UTSW 15 36244101 nonsense probably null
R1528:Rnf19a UTSW 15 36265655 missense possibly damaging 0.75
R1710:Rnf19a UTSW 15 36244207 missense probably damaging 1.00
R1835:Rnf19a UTSW 15 36265925 missense probably benign
R2110:Rnf19a UTSW 15 36254519 missense possibly damaging 0.79
R3118:Rnf19a UTSW 15 36241899 nonsense probably null
R3776:Rnf19a UTSW 15 36265912 missense probably benign 0.03
R4005:Rnf19a UTSW 15 36245628 missense probably damaging 0.98
R5184:Rnf19a UTSW 15 36244196 missense probably benign 0.05
R5297:Rnf19a UTSW 15 36247778 missense probably damaging 1.00
R5386:Rnf19a UTSW 15 36242039 missense probably benign 0.01
R5647:Rnf19a UTSW 15 36265963 start gained probably benign
R6451:Rnf19a UTSW 15 36253059 missense possibly damaging 0.64
R7003:Rnf19a UTSW 15 36254504 nonsense probably null
R7304:Rnf19a UTSW 15 36254452 missense probably damaging 0.98
R7893:Rnf19a UTSW 15 36241668 missense possibly damaging 0.95
R8808:Rnf19a UTSW 15 36241875 missense probably benign 0.00
R8864:Rnf19a UTSW 15 36265306 missense possibly damaging 0.80
R8940:Rnf19a UTSW 15 36260138 missense probably damaging 1.00
R9063:Rnf19a UTSW 15 36265469 nonsense probably null
R9093:Rnf19a UTSW 15 36253304 intron probably benign
R9135:Rnf19a UTSW 15 36253164 critical splice acceptor site probably null
R9525:Rnf19a UTSW 15 36247229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGGTCGTTTTCTACCTCAGG -3'
(R):5'- TCCGACACAACAGTGGAAGC -3'

Sequencing Primer
(F):5'- CCTCAGGAAGGGTGTTCACAG -3'
(R):5'- TGGATGACAGTGGTGCTACCC -3'
Posted On 2014-08-25