Mutagenetix > Incidental Mutations

Incidental Mutation 'R2005:Washc5'

225435

Institutional Source

Beutler Lab

Gene Symbol

Washc5

Ensembl Gene

ENSMUSG00000022350

Gene Name

WASH complex subunit 5

Synonyms

E430025E21Rik, strumpellin

MMRRC Submission

040014-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R2005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59331997-59374167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59341155 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 892 (L892P)

Ref Sequence

ENSEMBL: ENSMUSP00000022976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022976
AA Change: L892P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: L892P

Domain	Start	End	E-Value	Type
Pfam:Strumpellin	23	1103	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227725
AA Change: L442P

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	G	A	12: 118,877,827	A961V	probably benign	Het
Adcy10	A	G	1: 165,525,022	Y475C	probably benign	Het
Adgrb3	T	C	1: 25,111,718	M1145V	probably benign	Het
Akr1c21	A	G	13: 4,574,215	T23A	probably damaging	Het
Ankrd33b	A	T	15: 31,297,668	S314R	probably damaging	Het
Apc	T	C	18: 34,310,909		probably null	Het
Atg9a	T	A	1: 75,185,991	Q460L	probably benign	Het
Birc3	C	T	9: 7,860,341	C292Y	probably damaging	Het
Capn5	T	C	7: 98,129,363	I350V	probably benign	Het
Cc2d2a	G	A	5: 43,726,373		probably null	Het
Cdh22	T	A	2: 165,180,923	E76V	probably damaging	Het
Cdh8	T	C	8: 99,033,471		probably null	Het
Cdkn1b	ATTCTTCTTC	ATTCTTCTTCTTC	6: 134,921,956		probably benign	Het
Cfap54	T	A	10: 92,884,768	D2608V	unknown	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Cwf19l2	A	T	9: 3,430,720	N351Y	possibly damaging	Het
Cyp2c67	A	T	19: 39,643,345	M136K	probably damaging	Het
Ddx10	A	G	9: 53,240,475		probably null	Het
Ddx47	A	G	6: 135,018,121	N92S	probably benign	Het
Ddx50	T	A	10: 62,640,464	H306L	probably benign	Het
Dnajc27	A	G	12: 4,097,317	T167A	possibly damaging	Het
Dscam	T	G	16: 97,038,920	K162N	probably benign	Het
Eif4h	G	A	5: 134,627,677	T53I	probably benign	Het
Elmo2	T	C	2: 165,298,279	N332S	probably benign	Het
Ergic3	A	G	2: 156,011,108	N157S	possibly damaging	Het
F2rl1	G	T	13: 95,513,274	R367S	probably damaging	Het
Fbxo36	G	A	1: 84,900,069	A151T	probably benign	Het
Foxf2	G	T	13: 31,626,141	R21L	unknown	Het
Gmip	T	A	8: 69,814,043	H269Q	probably benign	Het
Gng4	T	A	13: 13,806,166	V32E	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Helz2	C	T	2: 181,231,329	R2396H	probably benign	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Itgb3bp	A	C	4: 99,814,058	N16K	probably benign	Het
Kcnt2	A	G	1: 140,553,018	M824V	probably damaging	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mmp25	G	A	17: 23,640,242	R144W	probably damaging	Het
Mmrn1	A	T	6: 60,976,084	I450F	possibly damaging	Het
Mroh2b	A	T	15: 4,917,158	K480M	probably damaging	Het
Nbn	T	A	4: 15,979,351	D445E	probably benign	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Olfr1118	T	A	2: 87,309,448	S240T	probably benign	Het
Olfr1166	A	G	2: 88,124,547	L146P	probably damaging	Het
Olfr378	A	T	11: 73,425,239	V248E	probably damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Pard3b	A	T	1: 62,144,891	E183D	probably benign	Het
Pde10a	G	A	17: 8,929,091		probably null	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Prdm13	T	C	4: 21,685,695		probably benign	Het
Rc3h2	T	A	2: 37,389,753	K461*	probably null	Het
Reep2	C	T	18: 34,845,621	T117M	probably damaging	Het
Rhbdd1	A	G	1: 82,340,810	N138S	probably benign	Het
Rnf19a	A	T	15: 36,241,770	F708I	possibly damaging	Het
Robo2	G	A	16: 73,933,115	H1069Y	possibly damaging	Het
Rpl9	C	T	5: 65,389,535	V112I	probably benign	Het
Sec16a	A	C	2: 26,439,080	S974R	probably benign	Het
Sfrp5	A	G	19: 42,198,836	M265T	probably benign	Het
Skint7	T	C	4: 111,984,850	I305T	probably benign	Het
Slc6a7	T	C	18: 61,001,641	D454G	possibly damaging	Het
Slco6c1	A	G	1: 97,081,489	I407T	probably damaging	Het
Slfn8	A	T	11: 83,004,150	M610K	probably damaging	Het
Spidr	A	G	16: 16,048,049	S299P	probably damaging	Het
Sptbn4	C	T	7: 27,366,419	W2034*	probably null	Het
Stard9	T	A	2: 120,664,945	F100L	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stc1	T	C	14: 69,031,647		probably null	Het
Sun2	T	C	15: 79,726,624	E667G	possibly damaging	Het
Tacc2	T	C	7: 130,731,550	S511P	probably damaging	Het
Tasp1	T	G	2: 139,977,678	K202Q	probably damaging	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tgds	A	G	14: 118,130,656	V35A	possibly damaging	Het
Tubgcp6	G	A	15: 89,104,166	T860I	probably benign	Het
Twf1	C	T	15: 94,585,447		probably null	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn2r117	A	G	17: 23,477,644	I263T	probably damaging	Het
Wnk4	T	C	11: 101,263,890	C302R	probably damaging	Het
Zfp395	A	G	14: 65,388,885	E191G	possibly damaging	Het
Zkscan17	A	G	11: 59,492,216	L302P	probably damaging	Het

Other mutations in Washc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Washc5	APN	15	59337276	missense	probably damaging	0.99
IGL01096:Washc5	APN	15	59350211	splice site	probably benign
IGL01305:Washc5	APN	15	59355839	nonsense	probably null
IGL01707:Washc5	APN	15	59342015	missense	possibly damaging	0.89
IGL01921:Washc5	APN	15	59342109	splice site	probably null
IGL02056:Washc5	APN	15	59350336	missense	possibly damaging	0.63
IGL02145:Washc5	APN	15	59369211	missense	probably benign
IGL02430:Washc5	APN	15	59366291	missense	probably damaging	1.00
IGL02450:Washc5	APN	15	59332317	nonsense	probably null
IGL03238:Washc5	APN	15	59346842	missense	probably damaging	1.00
IGL03351:Washc5	APN	15	59363350	splice site	probably benign
ANU22:Washc5	UTSW	15	59355839	nonsense	probably null
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0179:Washc5	UTSW	15	59352530	missense	probably benign	0.01
R0265:Washc5	UTSW	15	59338960	missense	probably benign	0.43
R0315:Washc5	UTSW	15	59341976	missense	probably damaging	1.00
R0545:Washc5	UTSW	15	59342093	missense	possibly damaging	0.50
R0611:Washc5	UTSW	15	59341158	missense	probably damaging	0.99
R0636:Washc5	UTSW	15	59359409	missense	probably benign	0.01
R1006:Washc5	UTSW	15	59369186	missense	probably benign	0.21
R1006:Washc5	UTSW	15	59369187	missense	probably benign	0.06
R1237:Washc5	UTSW	15	59338908	splice site	probably benign
R1835:Washc5	UTSW	15	59359340	missense	possibly damaging	0.86
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R2006:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2060:Washc5	UTSW	15	59350408	missense	probably damaging	1.00
R2134:Washc5	UTSW	15	59369234	missense	probably damaging	1.00
R2139:Washc5	UTSW	15	59350142	missense	probably damaging	1.00
R2177:Washc5	UTSW	15	59363269	nonsense	probably null
R2975:Washc5	UTSW	15	59345358	missense	probably damaging	1.00
R4088:Washc5	UTSW	15	59339862	missense	probably damaging	1.00
R4824:Washc5	UTSW	15	59333636	nonsense	probably null
R4843:Washc5	UTSW	15	59350371	missense	possibly damaging	0.95
R4991:Washc5	UTSW	15	59344080	missense	probably damaging	1.00
R4996:Washc5	UTSW	15	59333635	missense	probably benign
R5103:Washc5	UTSW	15	59350169	missense	probably damaging	1.00
R5312:Washc5	UTSW	15	59345528	splice site	probably null
R5591:Washc5	UTSW	15	59369163	missense	probably damaging	1.00
R6073:Washc5	UTSW	15	59335170	missense	possibly damaging	0.90
R6123:Washc5	UTSW	15	59335110	missense	probably damaging	1.00
R6156:Washc5	UTSW	15	59345399	missense	probably damaging	1.00
R6292:Washc5	UTSW	15	59355934	missense	probably damaging	1.00
R6297:Washc5	UTSW	15	59344046	missense	possibly damaging	0.61
R6374:Washc5	UTSW	15	59337195	missense	probably benign	0.14
R6659:Washc5	UTSW	15	59340890	critical splice donor site	probably null
R6880:Washc5	UTSW	15	59350172	missense	probably benign	0.00
R7146:Washc5	UTSW	15	59352501	nonsense	probably null
R7330:Washc5	UTSW	15	59333667	missense	probably benign	0.02
R7430:Washc5	UTSW	15	59369913	nonsense	probably null
R7490:Washc5	UTSW	15	59337204	missense	probably benign	0.18
R7532:Washc5	UTSW	15	59367411	missense	possibly damaging	0.46
R7560:Washc5	UTSW	15	59366192	missense	probably damaging	0.97
R7803:Washc5	UTSW	15	59368459	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGCACTCCAGATCTTCTGTG -3'
(R):5'- TAACTCCTCCTCAGAGCTGCTG -3'

Sequencing Primer
(F):5'- AAGCACTCCAGATCTTCTGTGTTTTG -3'
(R):5'- TGCTGCCCTTAGTAGAAACCTGAG -3'

Posted On

2014-08-25