Incidental Mutation 'R2005:Tubgcp6'
ID 225439
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Name tubulin, gamma complex component 6
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 88983300-89007411 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88988369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 860 (T860I)
Ref Sequence ENSEMBL: ENSMUSP00000040132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000166480]
AlphaFold G5E8P0
Predicted Effect probably benign
Transcript: ENSMUST00000041656
AA Change: T860I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: T860I

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
AA Change: T868I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: T868I

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163290
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164717
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168256
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169208
Predicted Effect probably benign
Transcript: ENSMUST00000170877
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 88,988,211 (GRCm39) missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 88,985,165 (GRCm39) missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89,006,600 (GRCm39) nonsense probably null
IGL01284:Tubgcp6 APN 15 88,994,258 (GRCm39) missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 88,991,728 (GRCm39) missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 88,992,199 (GRCm39) nonsense probably null
IGL01792:Tubgcp6 APN 15 88,985,484 (GRCm39) missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 88,987,691 (GRCm39) missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 88,985,117 (GRCm39) missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 88,986,518 (GRCm39) nonsense probably null
IGL02873:Tubgcp6 APN 15 88,988,027 (GRCm39) missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 88,992,302 (GRCm39) unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89,006,593 (GRCm39) missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 88,987,386 (GRCm39) missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89,006,639 (GRCm39) missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 88,987,268 (GRCm39) missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 88,985,190 (GRCm39) missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 88,991,645 (GRCm39) missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89,000,444 (GRCm39) missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89,000,444 (GRCm39) missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 88,984,811 (GRCm39) missense probably damaging 1.00
R2067:Tubgcp6 UTSW 15 88,988,692 (GRCm39) missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89,006,579 (GRCm39) missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89,006,677 (GRCm39) missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 88,987,187 (GRCm39) missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 88,986,568 (GRCm39) missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 88,987,285 (GRCm39) nonsense probably null
R3054:Tubgcp6 UTSW 15 89,006,806 (GRCm39) missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 88,988,617 (GRCm39) unclassified probably benign
R4350:Tubgcp6 UTSW 15 88,988,198 (GRCm39) missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 88,987,857 (GRCm39) missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 88,988,021 (GRCm39) missense probably benign
R4937:Tubgcp6 UTSW 15 88,985,752 (GRCm39) missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 88,990,494 (GRCm39) missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 88,987,693 (GRCm39) missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 88,983,748 (GRCm39) unclassified probably benign
R5122:Tubgcp6 UTSW 15 89,000,306 (GRCm39) missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 88,995,353 (GRCm39) missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 88,995,353 (GRCm39) missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 88,992,815 (GRCm39) missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 88,987,450 (GRCm39) missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 88,993,420 (GRCm39) splice site probably null
R6111:Tubgcp6 UTSW 15 88,985,123 (GRCm39) missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89,006,994 (GRCm39) missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89,007,080 (GRCm39) start gained probably benign
R7074:Tubgcp6 UTSW 15 89,004,839 (GRCm39) missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 88,985,232 (GRCm39) missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 88,987,173 (GRCm39) nonsense probably null
R7275:Tubgcp6 UTSW 15 88,987,146 (GRCm39) nonsense probably null
R7514:Tubgcp6 UTSW 15 89,004,728 (GRCm39) missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 88,986,526 (GRCm39) missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 88,984,925 (GRCm39) missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 88,988,426 (GRCm39) missense probably benign
R7721:Tubgcp6 UTSW 15 88,985,604 (GRCm39) missense probably damaging 1.00
R7980:Tubgcp6 UTSW 15 88,986,232 (GRCm39) missense probably benign 0.03
R7996:Tubgcp6 UTSW 15 88,993,231 (GRCm39) missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89,006,977 (GRCm39) missense probably benign 0.07
R8191:Tubgcp6 UTSW 15 89,004,843 (GRCm39) missense probably damaging 1.00
R8510:Tubgcp6 UTSW 15 88,987,152 (GRCm39) missense possibly damaging 0.91
R8839:Tubgcp6 UTSW 15 88,987,681 (GRCm39) missense possibly damaging 0.91
R8862:Tubgcp6 UTSW 15 89,006,824 (GRCm39) missense probably benign 0.03
R9044:Tubgcp6 UTSW 15 88,987,397 (GRCm39) missense possibly damaging 0.89
R9321:Tubgcp6 UTSW 15 88,992,186 (GRCm39) missense probably damaging 1.00
R9402:Tubgcp6 UTSW 15 88,987,064 (GRCm39) missense probably benign 0.01
R9428:Tubgcp6 UTSW 15 88,985,100 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTGACTGGGTAGCCTG -3'
(R):5'- TGTCAGCCACTGTTGCTGAG -3'

Sequencing Primer
(F):5'- CTGCTGTGAGTGCCGCTG -3'
(R):5'- ACTGTTGCTGAGCTCGC -3'
Posted On 2014-08-25