Mutagenetix > Incidental Mutation

Incidental Mutation 'R2005:Robo2'

225446

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

040014-MU

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R2005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73933115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 1069 (H1069Y)

Ref Sequence

ENSEMBL: ENSMUSP00000154353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000138852] [ENSMUST00000226478] [ENSMUST00000227347]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000116586

SMART Domains

Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	330	402	1.3e-11	SMART
IGc2	434	499	3.73e-12	SMART
FN3	526	608	1.42e-15	SMART
FN3	640	725	3.54e-2	SMART
FN3	740	827	6.15e-11	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	1044	1069	N/A	INTRINSIC
low complexity region	1076	1087	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117200

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117785
AA Change: H1065Y

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: H1065Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138852

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226478
AA Change: H1069Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000227347

Predicted Effect

probably benign
Transcript: ENSMUST00000231889

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	G	A	12: 118,877,827	A961V	probably benign	Het
Adcy10	A	G	1: 165,525,022	Y475C	probably benign	Het
Adgrb3	T	C	1: 25,111,718	M1145V	probably benign	Het
Akr1c21	A	G	13: 4,574,215	T23A	probably damaging	Het
Ankrd33b	A	T	15: 31,297,668	S314R	probably damaging	Het
Apc	T	C	18: 34,310,909		probably null	Het
Atg9a	T	A	1: 75,185,991	Q460L	probably benign	Het
Birc3	C	T	9: 7,860,341	C292Y	probably damaging	Het
Capn5	T	C	7: 98,129,363	I350V	probably benign	Het
Cc2d2a	G	A	5: 43,726,373		probably null	Het
Cdh22	T	A	2: 165,180,923	E76V	probably damaging	Het
Cdh8	T	C	8: 99,033,471		probably null	Het
Cdkn1b	ATTCTTCTTC	ATTCTTCTTCTTC	6: 134,921,956		probably benign	Het
Cfap54	T	A	10: 92,884,768	D2608V	unknown	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Cwf19l2	A	T	9: 3,430,720	N351Y	possibly damaging	Het
Cyp2c67	A	T	19: 39,643,345	M136K	probably damaging	Het
Ddx10	A	G	9: 53,240,475		probably null	Het
Ddx47	A	G	6: 135,018,121	N92S	probably benign	Het
Ddx50	T	A	10: 62,640,464	H306L	probably benign	Het
Dnajc27	A	G	12: 4,097,317	T167A	possibly damaging	Het
Dscam	T	G	16: 97,038,920	K162N	probably benign	Het
Eif4h	G	A	5: 134,627,677	T53I	probably benign	Het
Elmo2	T	C	2: 165,298,279	N332S	probably benign	Het
Ergic3	A	G	2: 156,011,108	N157S	possibly damaging	Het
F2rl1	G	T	13: 95,513,274	R367S	probably damaging	Het
Fbxo36	G	A	1: 84,900,069	A151T	probably benign	Het
Foxf2	G	T	13: 31,626,141	R21L	unknown	Het
Gmip	T	A	8: 69,814,043	H269Q	probably benign	Het
Gng4	T	A	13: 13,806,166	V32E	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Helz2	C	T	2: 181,231,329	R2396H	probably benign	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Itgb3bp	A	C	4: 99,814,058	N16K	probably benign	Het
Kcnt2	A	G	1: 140,553,018	M824V	probably damaging	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mmp25	G	A	17: 23,640,242	R144W	probably damaging	Het
Mmrn1	A	T	6: 60,976,084	I450F	possibly damaging	Het
Mroh2b	A	T	15: 4,917,158	K480M	probably damaging	Het
Nbn	T	A	4: 15,979,351	D445E	probably benign	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Olfr1118	T	A	2: 87,309,448	S240T	probably benign	Het
Olfr1166	A	G	2: 88,124,547	L146P	probably damaging	Het
Olfr378	A	T	11: 73,425,239	V248E	probably damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Pard3b	A	T	1: 62,144,891	E183D	probably benign	Het
Pde10a	G	A	17: 8,929,091		probably null	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Prdm13	T	C	4: 21,685,695		probably benign	Het
Rc3h2	T	A	2: 37,389,753	K461*	probably null	Het
Reep2	C	T	18: 34,845,621	T117M	probably damaging	Het
Rhbdd1	A	G	1: 82,340,810	N138S	probably benign	Het
Rnf19a	A	T	15: 36,241,770	F708I	possibly damaging	Het
Rpl9	C	T	5: 65,389,535	V112I	probably benign	Het
Sec16a	A	C	2: 26,439,080	S974R	probably benign	Het
Sfrp5	A	G	19: 42,198,836	M265T	probably benign	Het
Skint7	T	C	4: 111,984,850	I305T	probably benign	Het
Slc6a7	T	C	18: 61,001,641	D454G	possibly damaging	Het
Slco6c1	A	G	1: 97,081,489	I407T	probably damaging	Het
Slfn8	A	T	11: 83,004,150	M610K	probably damaging	Het
Spidr	A	G	16: 16,048,049	S299P	probably damaging	Het
Sptbn4	C	T	7: 27,366,419	W2034*	probably null	Het
Stard9	T	A	2: 120,664,945	F100L	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stc1	T	C	14: 69,031,647		probably null	Het
Sun2	T	C	15: 79,726,624	E667G	possibly damaging	Het
Tacc2	T	C	7: 130,731,550	S511P	probably damaging	Het
Tasp1	T	G	2: 139,977,678	K202Q	probably damaging	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tgds	A	G	14: 118,130,656	V35A	possibly damaging	Het
Tubgcp6	G	A	15: 89,104,166	T860I	probably benign	Het
Twf1	C	T	15: 94,585,447		probably null	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn2r117	A	G	17: 23,477,644	I263T	probably damaging	Het
Washc5	A	G	15: 59,341,155	L892P	possibly damaging	Het
Wnk4	T	C	11: 101,263,890	C302R	probably damaging	Het
Zfp395	A	G	14: 65,388,885	E191G	possibly damaging	Het
Zkscan17	A	G	11: 59,492,216	L302P	probably damaging	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0620:Robo2	UTSW	16	73967802	missense	possibly damaging	0.92
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1195:Robo2	UTSW	16	73916128	splice site	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1761:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4454:Robo2	UTSW	16	74352519	intron	probably benign
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6153:Robo2	UTSW	16	73920729	missense	probably damaging	1.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7720:Robo2	UTSW	16	73897015	missense	probably benign	0.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
R7849:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R7881:Robo2	UTSW	16	73920697	missense	probably benign	0.00
R7897:Robo2	UTSW	16	73898950	missense	probably benign
R8135:Robo2	UTSW	16	73933160	missense	probably benign	0.04
R8297:Robo2	UTSW	16	74015926	nonsense	probably null
R8307:Robo2	UTSW	16	73956610	missense	probably damaging	1.00
R8379:Robo2	UTSW	16	73933700	missense	probably damaging	0.99
R8393:Robo2	UTSW	16	73978494	missense	probably damaging	1.00
R8474:Robo2	UTSW	16	73948262	missense	probably damaging	1.00
R8500:Robo2	UTSW	16	73948340	missense	probably damaging	1.00
R8721:Robo2	UTSW	16	73906910	missense
R8734:Robo2	UTSW	16	73967763	splice site	probably benign
R8735:Robo2	UTSW	16	73958359	missense	probably damaging	1.00
R8840:Robo2	UTSW	16	73985682	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973261	missense	probably damaging	1.00
R8937:Robo2	UTSW	16	73973262	missense	probably damaging	1.00
R8968:Robo2	UTSW	16	73971053	critical splice donor site	probably null
R9134:Robo2	UTSW	16	73906850	missense
R9622:Robo2	UTSW	16	73933064	missense	probably benign	0.02
R9662:Robo2	UTSW	16	73961678	critical splice donor site	probably null
R9708:Robo2	UTSW	16	73973309	missense	possibly damaging	0.70
R9779:Robo2	UTSW	16	73971077	missense	probably damaging	0.97
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00
Z1176:Robo2	UTSW	16	73933591	missense	probably benign	0.35
Z1177:Robo2	UTSW	16	73940299	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGGACAGCAATATTCTCCCTCC -3'
(R):5'- AAGGACAGATCAAACATTCTTCTGC -3'

Sequencing Primer
(F):5'- TGCTAGATAAATGCCTGGAACTG -3'
(R):5'- ACAGATCAAACATTCTTCTGCTATCC -3'

Posted On

2014-08-25