Incidental Mutation 'R2005:Robo2'
ID 225446
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Name roundabout guidance receptor 2
Synonyms 2600013A04Rik, 9430089E08Rik, D230004I22Rik
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 73688727-74208713 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73730003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1069 (H1069Y)
Ref Sequence ENSEMBL: ENSMUSP00000154353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000138852] [ENSMUST00000226478] [ENSMUST00000227347]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000116586
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117200
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117785
AA Change: H1065Y

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: H1065Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138852
Predicted Effect possibly damaging
Transcript: ENSMUST00000226478
AA Change: H1069Y

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000227347
Predicted Effect probably benign
Transcript: ENSMUST00000231889
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73,758,588 (GRCm39) missense probably benign
IGL00849:Robo2 APN 16 73,770,665 (GRCm39) missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73,782,579 (GRCm39) missense probably damaging 0.98
IGL00944:Robo2 APN 16 73,730,585 (GRCm39) missense possibly damaging 0.92
IGL00955:Robo2 APN 16 73,812,860 (GRCm39) missense probably damaging 1.00
IGL00970:Robo2 APN 16 73,693,934 (GRCm39) missense probably benign 0.00
IGL01020:Robo2 APN 16 73,725,039 (GRCm39) missense probably benign 0.06
IGL01347:Robo2 APN 16 74,149,744 (GRCm39) missense probably damaging 1.00
IGL02280:Robo2 APN 16 73,843,704 (GRCm39) missense probably damaging 1.00
IGL02424:Robo2 APN 16 73,770,189 (GRCm39) missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73,753,380 (GRCm39) missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74,055,954 (GRCm38) intron probably benign
P0018:Robo2 UTSW 16 73,843,694 (GRCm39) missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73,753,525 (GRCm39) missense probably damaging 1.00
R0324:Robo2 UTSW 16 73,764,739 (GRCm39) missense probably damaging 1.00
R0539:Robo2 UTSW 16 73,782,462 (GRCm39) splice site probably benign
R0620:Robo2 UTSW 16 73,764,690 (GRCm39) missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73,713,093 (GRCm39) missense probably benign 0.05
R0701:Robo2 UTSW 16 73,843,762 (GRCm39) missense probably damaging 1.00
R1155:Robo2 UTSW 16 73,831,996 (GRCm39) missense probably damaging 1.00
R1168:Robo2 UTSW 16 73,745,184 (GRCm39) missense probably damaging 1.00
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1195:Robo2 UTSW 16 73,713,016 (GRCm39) splice site probably null
R1317:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1422:Robo2 UTSW 16 73,775,336 (GRCm39) missense probably damaging 0.99
R1452:Robo2 UTSW 16 73,758,798 (GRCm39) missense probably damaging 1.00
R1649:Robo2 UTSW 16 73,695,889 (GRCm39) missense probably benign 0.36
R1709:Robo2 UTSW 16 73,753,411 (GRCm39) missense possibly damaging 0.83
R1751:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1761:Robo2 UTSW 16 73,831,912 (GRCm39) missense probably damaging 1.00
R1885:Robo2 UTSW 16 73,713,033 (GRCm39) missense probably benign 0.00
R1911:Robo2 UTSW 16 73,755,213 (GRCm39) missense probably damaging 1.00
R1919:Robo2 UTSW 16 73,696,042 (GRCm39) missense probably benign
R2851:Robo2 UTSW 16 73,758,776 (GRCm39) missense probably damaging 1.00
R3732:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73,717,635 (GRCm39) missense possibly damaging 0.64
R3913:Robo2 UTSW 16 73,831,893 (GRCm39) missense probably damaging 1.00
R3956:Robo2 UTSW 16 73,758,755 (GRCm39) missense probably damaging 1.00
R4394:Robo2 UTSW 16 73,745,267 (GRCm39) missense probably benign 0.13
R4426:Robo2 UTSW 16 73,745,154 (GRCm39) missense probably damaging 1.00
R4437:Robo2 UTSW 16 73,770,132 (GRCm39) missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74,149,407 (GRCm39) intron probably benign
R4478:Robo2 UTSW 16 73,812,761 (GRCm39) missense probably damaging 1.00
R4586:Robo2 UTSW 16 73,758,761 (GRCm39) missense probably damaging 0.96
R4621:Robo2 UTSW 16 73,782,821 (GRCm39) missense probably benign 0.00
R4673:Robo2 UTSW 16 73,701,266 (GRCm39) splice site probably null
R4798:Robo2 UTSW 16 74,149,633 (GRCm39) missense probably damaging 1.00
R4812:Robo2 UTSW 16 73,713,176 (GRCm39) missense probably benign 0.00
R4855:Robo2 UTSW 16 73,768,079 (GRCm39) missense probably damaging 1.00
R4910:Robo2 UTSW 16 73,730,666 (GRCm39) missense probably damaging 0.99
R4916:Robo2 UTSW 16 73,695,803 (GRCm39) missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74,149,726 (GRCm39) missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73,770,673 (GRCm39) missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73,695,853 (GRCm39) missense probably benign 0.20
R5447:Robo2 UTSW 16 73,770,654 (GRCm39) nonsense probably null
R5542:Robo2 UTSW 16 73,695,853 (GRCm39) missense probably benign 0.20
R5545:Robo2 UTSW 16 73,758,635 (GRCm39) missense probably damaging 1.00
R5646:Robo2 UTSW 16 73,758,707 (GRCm39) missense probably damaging 0.99
R5734:Robo2 UTSW 16 74,149,672 (GRCm39) missense probably damaging 1.00
R5892:Robo2 UTSW 16 73,692,668 (GRCm39) utr 3 prime probably benign
R5960:Robo2 UTSW 16 73,730,603 (GRCm39) missense probably damaging 1.00
R6126:Robo2 UTSW 16 73,717,570 (GRCm39) missense probably benign 0.00
R6130:Robo2 UTSW 16 73,717,570 (GRCm39) missense probably benign 0.00
R6153:Robo2 UTSW 16 73,717,617 (GRCm39) missense probably damaging 1.00
R6240:Robo2 UTSW 16 73,779,027 (GRCm39) missense probably damaging 1.00
R6247:Robo2 UTSW 16 73,764,672 (GRCm39) missense probably damaging 1.00
R6304:Robo2 UTSW 16 73,755,196 (GRCm39) missense probably damaging 1.00
R6337:Robo2 UTSW 16 73,725,039 (GRCm39) missense probably benign 0.06
R6431:Robo2 UTSW 16 73,843,697 (GRCm39) nonsense probably null
R6440:Robo2 UTSW 16 73,713,010 (GRCm39) missense probably benign 0.31
R6596:Robo2 UTSW 16 73,767,996 (GRCm39) missense probably damaging 1.00
R6919:Robo2 UTSW 16 73,758,755 (GRCm39) missense probably damaging 1.00
R6927:Robo2 UTSW 16 73,778,946 (GRCm39) missense probably damaging 1.00
R7029:Robo2 UTSW 16 73,745,225 (GRCm39) missense probably damaging 1.00
R7078:Robo2 UTSW 16 74,149,504 (GRCm39) missense probably damaging 1.00
R7092:Robo2 UTSW 16 73,753,531 (GRCm39) missense probably damaging 0.99
R7136:Robo2 UTSW 16 73,753,438 (GRCm39) missense probably damaging 0.99
R7192:Robo2 UTSW 16 73,717,638 (GRCm39) missense probably benign 0.19
R7569:Robo2 UTSW 16 73,832,003 (GRCm39) missense possibly damaging 0.82
R7686:Robo2 UTSW 16 73,755,293 (GRCm39) missense probably damaging 1.00
R7720:Robo2 UTSW 16 73,693,903 (GRCm39) missense probably benign 0.00
R7772:Robo2 UTSW 16 73,758,777 (GRCm39) missense probably benign 0.24
R7822:Robo2 UTSW 16 73,770,059 (GRCm39) missense probably damaging 1.00
R7849:Robo2 UTSW 16 73,770,132 (GRCm39) missense possibly damaging 0.88
R7881:Robo2 UTSW 16 73,717,585 (GRCm39) missense probably benign 0.00
R7897:Robo2 UTSW 16 73,695,838 (GRCm39) missense probably benign
R8135:Robo2 UTSW 16 73,730,048 (GRCm39) missense probably benign 0.04
R8297:Robo2 UTSW 16 73,812,814 (GRCm39) nonsense probably null
R8307:Robo2 UTSW 16 73,753,498 (GRCm39) missense probably damaging 1.00
R8379:Robo2 UTSW 16 73,730,588 (GRCm39) missense probably damaging 0.99
R8393:Robo2 UTSW 16 73,775,382 (GRCm39) missense probably damaging 1.00
R8474:Robo2 UTSW 16 73,745,150 (GRCm39) missense probably damaging 1.00
R8500:Robo2 UTSW 16 73,745,228 (GRCm39) missense probably damaging 1.00
R8721:Robo2 UTSW 16 73,703,798 (GRCm39) missense
R8734:Robo2 UTSW 16 73,764,651 (GRCm39) splice site probably benign
R8735:Robo2 UTSW 16 73,755,247 (GRCm39) missense probably damaging 1.00
R8840:Robo2 UTSW 16 73,782,570 (GRCm39) missense probably damaging 1.00
R8937:Robo2 UTSW 16 73,770,150 (GRCm39) missense probably damaging 1.00
R8937:Robo2 UTSW 16 73,770,149 (GRCm39) missense probably damaging 1.00
R8968:Robo2 UTSW 16 73,767,941 (GRCm39) critical splice donor site probably null
R9134:Robo2 UTSW 16 73,703,738 (GRCm39) missense
R9622:Robo2 UTSW 16 73,729,952 (GRCm39) missense probably benign 0.02
R9662:Robo2 UTSW 16 73,758,566 (GRCm39) critical splice donor site probably null
R9708:Robo2 UTSW 16 73,770,197 (GRCm39) missense possibly damaging 0.70
R9779:Robo2 UTSW 16 73,767,965 (GRCm39) missense probably damaging 0.97
X0063:Robo2 UTSW 16 73,842,716 (GRCm39) missense probably damaging 1.00
Z1176:Robo2 UTSW 16 73,730,479 (GRCm39) missense probably benign 0.35
Z1177:Robo2 UTSW 16 73,737,187 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGACAGCAATATTCTCCCTCC -3'
(R):5'- AAGGACAGATCAAACATTCTTCTGC -3'

Sequencing Primer
(F):5'- TGCTAGATAAATGCCTGGAACTG -3'
(R):5'- ACAGATCAAACATTCTTCTGCTATCC -3'
Posted On 2014-08-25