Mutagenetix > Incidental Mutations

Incidental Mutation 'R2005:Pde10a'

225450

Institutional Source

Beutler Lab

Gene Symbol

Pde10a

Ensembl Gene

ENSMUSG00000023868

Gene Name

phosphodiesterase 10A

Synonyms

MMRRC Submission

040014-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8525372-8986648 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to A at 8929091 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]

Predicted Effect

probably null
Transcript: ENSMUST00000024647

SMART Domains

Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089085

SMART Domains

Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	101	254	1.44e-3	SMART
GAF	276	432	6.56e-29	SMART
HDc	522	688	9.04e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115715

SMART Domains

Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	21	174	1.44e-3	SMART
GAF	196	352	6.56e-29	SMART
HDc	442	608	9.04e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115717

Predicted Effect

probably null
Transcript: ENSMUST00000115720

SMART Domains

Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	84	237	1.44e-3	SMART
GAF	259	415	6.56e-29	SMART
HDc	505	671	9.04e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000115724

SMART Domains

Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	95	248	1.44e-3	SMART
GAF	270	426	6.56e-29	SMART
HDc	516	682	9.04e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136160

Predicted Effect

probably null
Transcript: ENSMUST00000149440

SMART Domains

Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868

Domain	Start	End	E-Value	Type
GAF	32	185	1.44e-3	SMART
GAF	207	363	6.56e-29	SMART
HDc	453	619	9.04e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000231430

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	G	A	12: 118,877,827	A961V	probably benign	Het
Adcy10	A	G	1: 165,525,022	Y475C	probably benign	Het
Adgrb3	T	C	1: 25,111,718	M1145V	probably benign	Het
Akr1c21	A	G	13: 4,574,215	T23A	probably damaging	Het
Ankrd33b	A	T	15: 31,297,668	S314R	probably damaging	Het
Apc	T	C	18: 34,310,909		probably null	Het
Atg9a	T	A	1: 75,185,991	Q460L	probably benign	Het
Birc3	C	T	9: 7,860,341	C292Y	probably damaging	Het
Capn5	T	C	7: 98,129,363	I350V	probably benign	Het
Cc2d2a	G	A	5: 43,726,373		probably null	Het
Cdh22	T	A	2: 165,180,923	E76V	probably damaging	Het
Cdh8	T	C	8: 99,033,471		probably null	Het
Cdkn1b	ATTCTTCTTC	ATTCTTCTTCTTC	6: 134,921,956		probably benign	Het
Cfap54	T	A	10: 92,884,768	D2608V	unknown	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Cwf19l2	A	T	9: 3,430,720	N351Y	possibly damaging	Het
Cyp2c67	A	T	19: 39,643,345	M136K	probably damaging	Het
Ddx10	A	G	9: 53,240,475		probably null	Het
Ddx47	A	G	6: 135,018,121	N92S	probably benign	Het
Ddx50	T	A	10: 62,640,464	H306L	probably benign	Het
Dnajc27	A	G	12: 4,097,317	T167A	possibly damaging	Het
Dscam	T	G	16: 97,038,920	K162N	probably benign	Het
Eif4h	G	A	5: 134,627,677	T53I	probably benign	Het
Elmo2	T	C	2: 165,298,279	N332S	probably benign	Het
Ergic3	A	G	2: 156,011,108	N157S	possibly damaging	Het
F2rl1	G	T	13: 95,513,274	R367S	probably damaging	Het
Fbxo36	G	A	1: 84,900,069	A151T	probably benign	Het
Foxf2	G	T	13: 31,626,141	R21L	unknown	Het
Gmip	T	A	8: 69,814,043	H269Q	probably benign	Het
Gng4	T	A	13: 13,806,166	V32E	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Helz2	C	T	2: 181,231,329	R2396H	probably benign	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Itgb3bp	A	C	4: 99,814,058	N16K	probably benign	Het
Kcnt2	A	G	1: 140,553,018	M824V	probably damaging	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mmp25	G	A	17: 23,640,242	R144W	probably damaging	Het
Mmrn1	A	T	6: 60,976,084	I450F	possibly damaging	Het
Mroh2b	A	T	15: 4,917,158	K480M	probably damaging	Het
Nbn	T	A	4: 15,979,351	D445E	probably benign	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Olfr1118	T	A	2: 87,309,448	S240T	probably benign	Het
Olfr1166	A	G	2: 88,124,547	L146P	probably damaging	Het
Olfr378	A	T	11: 73,425,239	V248E	probably damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Pard3b	A	T	1: 62,144,891	E183D	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Prdm13	T	C	4: 21,685,695		probably benign	Het
Rc3h2	T	A	2: 37,389,753	K461*	probably null	Het
Reep2	C	T	18: 34,845,621	T117M	probably damaging	Het
Rhbdd1	A	G	1: 82,340,810	N138S	probably benign	Het
Rnf19a	A	T	15: 36,241,770	F708I	possibly damaging	Het
Robo2	G	A	16: 73,933,115	H1069Y	possibly damaging	Het
Rpl9	C	T	5: 65,389,535	V112I	probably benign	Het
Sec16a	A	C	2: 26,439,080	S974R	probably benign	Het
Sfrp5	A	G	19: 42,198,836	M265T	probably benign	Het
Skint7	T	C	4: 111,984,850	I305T	probably benign	Het
Slc6a7	T	C	18: 61,001,641	D454G	possibly damaging	Het
Slco6c1	A	G	1: 97,081,489	I407T	probably damaging	Het
Slfn8	A	T	11: 83,004,150	M610K	probably damaging	Het
Spidr	A	G	16: 16,048,049	S299P	probably damaging	Het
Sptbn4	C	T	7: 27,366,419	W2034*	probably null	Het
Stard9	T	A	2: 120,664,945	F100L	possibly damaging	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stc1	T	C	14: 69,031,647		probably null	Het
Sun2	T	C	15: 79,726,624	E667G	possibly damaging	Het
Tacc2	T	C	7: 130,731,550	S511P	probably damaging	Het
Tasp1	T	G	2: 139,977,678	K202Q	probably damaging	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tgds	A	G	14: 118,130,656	V35A	possibly damaging	Het
Tubgcp6	G	A	15: 89,104,166	T860I	probably benign	Het
Twf1	C	T	15: 94,585,447		probably null	Het
Vangl1	A	G	3: 102,163,466	S385P	probably benign	Het
Vmn2r117	A	G	17: 23,477,644	I263T	probably damaging	Het
Washc5	A	G	15: 59,341,155	L892P	possibly damaging	Het
Wnk4	T	C	11: 101,263,890	C302R	probably damaging	Het
Zfp395	A	G	14: 65,388,885	E191G	possibly damaging	Het
Zkscan17	A	G	11: 59,492,216	L302P	probably damaging	Het

Other mutations in Pde10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:Pde10a	APN	17	8944970	missense	probably damaging	1.00
IGL01762:Pde10a	APN	17	8942918	missense	possibly damaging	0.74
IGL01814:Pde10a	APN	17	8929107	start codon destroyed	probably null	0.00
IGL02053:Pde10a	APN	17	8974769	missense	probably damaging	1.00
IGL02386:Pde10a	APN	17	8953804	missense	possibly damaging	0.93
IGL02573:Pde10a	APN	17	8961890	missense	probably benign	0.38
IGL02583:Pde10a	APN	17	8981630	missense	probably benign	0.23
IGL02649:Pde10a	APN	17	8953772	missense	probably damaging	1.00
IGL02992:Pde10a	APN	17	8949461	missense	probably damaging	0.97
IGL03109:Pde10a	APN	17	8929214	critical splice donor site	probably null
brautigam	UTSW	17	8964677	missense	possibly damaging	0.78
Bride	UTSW	17	8949430	missense	possibly damaging	0.60
buzzed	UTSW	17	8930537	missense	probably damaging	1.00
Gracile	UTSW	17	8961920	missense	possibly damaging	0.63
Nubile	UTSW	17	8967462	missense	probably damaging	1.00
thunderball	UTSW	17	8969589	missense	probably damaging	1.00
R0004:Pde10a	UTSW	17	8981576	missense	probably benign	0.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0015:Pde10a	UTSW	17	8977197	missense	probably damaging	1.00
R0650:Pde10a	UTSW	17	8942965	missense	probably damaging	1.00
R1173:Pde10a	UTSW	17	8920546	splice site	probably benign
R1386:Pde10a	UTSW	17	8953742	missense	probably damaging	1.00
R1458:Pde10a	UTSW	17	8964708	missense	probably damaging	0.98
R1598:Pde10a	UTSW	17	8929144	missense	probably damaging	1.00
R1661:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1665:Pde10a	UTSW	17	8898870	missense	probably damaging	1.00
R1883:Pde10a	UTSW	17	8978944	missense	possibly damaging	0.86
R1960:Pde10a	UTSW	17	8942918	missense	possibly damaging	0.74
R2071:Pde10a	UTSW	17	8961995	missense	probably benign	0.22
R2121:Pde10a	UTSW	17	8977215	missense	probably damaging	1.00
R2376:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R3721:Pde10a	UTSW	17	8969589	missense	probably damaging	1.00
R3872:Pde10a	UTSW	17	8757091	missense	possibly damaging	0.92
R4627:Pde10a	UTSW	17	8981652	missense	probably damaging	1.00
R4652:Pde10a	UTSW	17	8757053	missense	possibly damaging	0.82
R5107:Pde10a	UTSW	17	8944970	missense	probably damaging	1.00
R5184:Pde10a	UTSW	17	8977155	missense	probably damaging	1.00
R5354:Pde10a	UTSW	17	8961980	missense	probably damaging	0.97
R5735:Pde10a	UTSW	17	8941192	missense	probably damaging	0.99
R5878:Pde10a	UTSW	17	8949372	missense	possibly damaging	0.85
R5921:Pde10a	UTSW	17	8930537	missense	probably damaging	1.00
R6027:Pde10a	UTSW	17	8964677	missense	possibly damaging	0.78
R6145:Pde10a	UTSW	17	8929117	missense	probably damaging	1.00
R6279:Pde10a	UTSW	17	8978957	missense	probably damaging	0.99
R6409:Pde10a	UTSW	17	8949438	missense	probably damaging	1.00
R6870:Pde10a	UTSW	17	8967524	missense	possibly damaging	0.56
R6947:Pde10a	UTSW	17	8969592	missense	probably damaging	1.00
R7072:Pde10a	UTSW	17	8943026	missense	probably benign	0.40
R7084:Pde10a	UTSW	17	8941162	missense	probably benign	0.25
R7294:Pde10a	UTSW	17	8757021	missense	probably benign
R7339:Pde10a	UTSW	17	8757028	missense	probably benign	0.01
R7347:Pde10a	UTSW	17	8967462	missense	probably damaging	1.00
R7373:Pde10a	UTSW	17	8942992	missense	probably benign	0.00
R7481:Pde10a	UTSW	17	8949430	missense	possibly damaging	0.60
R7833:Pde10a	UTSW	17	8961920	missense	possibly damaging	0.63
R7923:Pde10a	UTSW	17	8929132	missense	probably benign	0.40
R8053:Pde10a	UTSW	17	8974772	missense	probably benign	0.12
R8137:Pde10a	UTSW	17	8974815	missense	possibly damaging	0.90
R8722:Pde10a	UTSW	17	8944940	missense	probably benign	0.01
R8918:Pde10a	UTSW	17	8941231	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CCCAGATAGTTCAGTTTCAAGTCTC -3'
(R):5'- GTTTCCACTTCAGACTGAGCC -3'

Sequencing Primer
(F):5'- AAGTCTCCCTGTTTTACAAGTGG -3'
(R):5'- GGTGATGAAGAGTCCCATTCC -3'

Posted On

2014-08-25