Incidental Mutation 'R2039:Hhla1'
ID225453
Institutional Source Beutler Lab
Gene Symbol Hhla1
Ensembl Gene ENSMUSG00000072511
Gene NameHERV-H LTR-associating 1
SynonymsF930104E18Rik
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location65922443-65976804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65936377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 273 (T273I)
Ref Sequence ENSEMBL: ENSMUSP00000098149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100584
AA Change: T273I

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098149
Gene: ENSMUSG00000072511
AA Change: T273I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Meta Mutation Damage Score 0.1029 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Hhla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Hhla1 APN 15 65941961 missense probably damaging 1.00
IGL02531:Hhla1 APN 15 65967407 splice site probably benign
IGL02609:Hhla1 APN 15 65930614 splice site probably benign
IGL02948:Hhla1 APN 15 65942693 missense probably damaging 1.00
IGL03063:Hhla1 APN 15 65941790 missense probably damaging 1.00
IGL03411:Hhla1 APN 15 65930229 critical splice donor site probably null
encroachment UTSW 15 65948485 missense probably damaging 1.00
trespass UTSW 15 65936382 nonsense probably null
P4717OSA:Hhla1 UTSW 15 65924001 missense probably damaging 0.99
R0277:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0323:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0492:Hhla1 UTSW 15 65936291 missense probably benign
R1546:Hhla1 UTSW 15 65933327 missense probably benign 0.10
R2112:Hhla1 UTSW 15 65936383 missense probably benign 0.00
R2405:Hhla1 UTSW 15 65936311 nonsense probably null
R4804:Hhla1 UTSW 15 65923099 missense probably benign 0.01
R5512:Hhla1 UTSW 15 65924016 missense probably benign 0.00
R5651:Hhla1 UTSW 15 65941814 missense probably damaging 1.00
R6012:Hhla1 UTSW 15 65948490 missense probably damaging 1.00
R6237:Hhla1 UTSW 15 65941797 missense probably damaging 1.00
R6837:Hhla1 UTSW 15 65948485 missense probably damaging 1.00
R7506:Hhla1 UTSW 15 65936382 nonsense probably null
R7657:Hhla1 UTSW 15 65965459 missense probably damaging 0.99
Z1177:Hhla1 UTSW 15 65941775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTTAAGGTGCTGGGAAGAGTTAG -3'
(R):5'- GCCTAATTGTCTTTCATGACTCAAC -3'

Sequencing Primer
(F):5'- GGGAAGAGTTAGATGGAGATATTTTG -3'
(R):5'- CAACAGTTCTATGTGCCCAAAGTGG -3'
Posted On2014-08-25