Incidental Mutation 'R2039:Eef1d'
ID225455
Institutional Source Beutler Lab
Gene Symbol Eef1d
Ensembl Gene ENSMUSG00000055762
Gene Nameeukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
Synonyms
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location75894205-75909556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75895769 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 252 (D252G)
Ref Sequence ENSEMBL: ENSMUSP00000087109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000023237] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000137426] [ENSMUST00000141268] [ENSMUST00000144614] [ENSMUST00000151066] [ENSMUST00000154584] [ENSMUST00000229571]
Predicted Effect probably benign
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023237
SMART Domains Protein: ENSMUSP00000023237
Gene: ENSMUSG00000022574

DomainStartEndE-ValueType
PDB:4MZY|A 16 522 2e-70 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055220
Predicted Effect probably damaging
Transcript: ENSMUST00000089680
AA Change: D252G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762
AA Change: D252G

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089681
AA Change: D636G

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762
AA Change: D636G

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109972
AA Change: D233G

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762
AA Change: D233G

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109975
AA Change: D636G

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762
AA Change: D636G

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116440
AA Change: D233G

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762
AA Change: D233G

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134222
Predicted Effect probably benign
Transcript: ENSMUST00000137426
AA Change: D528G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114753
Gene: ENSMUSG00000055762
AA Change: D528G

DomainStartEndE-ValueType
low complexity region 53 72 N/A INTRINSIC
internal_repeat_1 160 179 9.48e-6 PROSPERO
internal_repeat_1 305 324 9.48e-6 PROSPERO
low complexity region 330 346 N/A INTRINSIC
coiled coil region 353 391 N/A INTRINSIC
EF-1_beta_acid 430 457 2.53e-4 SMART
EF1_GNE 466 552 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151066
AA Change: D166G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762
AA Change: D166G

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154584
AA Change: D257G

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762
AA Change: D257G

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230739
Meta Mutation Damage Score 0.8192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Eef1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Eef1d APN 15 75896855 missense probably benign 0.10
IGL02265:Eef1d APN 15 75903434 missense probably benign 0.00
IGL02609:Eef1d APN 15 75896313 missense probably null 1.00
IGL02671:Eef1d APN 15 75895805 missense probably damaging 1.00
IGL02728:Eef1d APN 15 75903096 missense probably damaging 1.00
PIT4131001:Eef1d UTSW 15 75903732 missense probably benign 0.01
R0034:Eef1d UTSW 15 75902959 missense probably benign
R0523:Eef1d UTSW 15 75903156 missense probably benign
R0831:Eef1d UTSW 15 75896806 unclassified probably benign
R1164:Eef1d UTSW 15 75902677 critical splice donor site probably null
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1467:Eef1d UTSW 15 75895921 missense probably damaging 1.00
R1594:Eef1d UTSW 15 75896346 missense probably damaging 1.00
R1796:Eef1d UTSW 15 75901175 missense probably damaging 1.00
R2093:Eef1d UTSW 15 75902701 missense probably benign 0.00
R2119:Eef1d UTSW 15 75903213 missense probably benign 0.43
R2372:Eef1d UTSW 15 75896317 missense probably damaging 1.00
R4401:Eef1d UTSW 15 75902920 missense probably benign
R4403:Eef1d UTSW 15 75902920 missense probably benign
R4425:Eef1d UTSW 15 75902799 missense possibly damaging 0.92
R4614:Eef1d UTSW 15 75903576 missense probably benign 0.00
R4791:Eef1d UTSW 15 75903682 missense possibly damaging 0.85
R4864:Eef1d UTSW 15 75903406 missense possibly damaging 0.73
R5376:Eef1d UTSW 15 75903189 missense probably benign 0.25
R5377:Eef1d UTSW 15 75903189 missense probably benign 0.25
R5415:Eef1d UTSW 15 75903181 missense probably benign 0.00
R6966:Eef1d UTSW 15 75903709 missense probably benign 0.06
R7640:Eef1d UTSW 15 75902707 missense probably damaging 1.00
Z1177:Eef1d UTSW 15 75902878 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACACTCTGCACCTGTGGATG -3'
(R):5'- CTAGAGGTTTCTGAGATGGCTCAC -3'

Sequencing Primer
(F):5'- TCTGCACCTGTGGATGGAGAC -3'
(R):5'- TCTGAGATGGCTCACTCAGAC -3'
Posted On2014-08-25