Incidental Mutation 'R2005:Tdrd6'
ID 225458
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Name tudor domain containing 6
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 43926226-43941190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43939546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 501 (F501L)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000045717
AA Change: F501L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: F501L

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168073
AA Change: F501L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: F501L

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Apc T C 18: 34,443,962 (GRCm39) probably null Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43,939,051 (GRCm39) missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43,928,087 (GRCm39) missense probably benign
IGL00845:Tdrd6 APN 17 43,937,607 (GRCm39) missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43,936,659 (GRCm39) missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43,935,657 (GRCm39) missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43,938,871 (GRCm39) missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43,936,065 (GRCm39) missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43,936,837 (GRCm39) missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43,939,100 (GRCm39) missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43,940,242 (GRCm39) missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43,939,281 (GRCm39) missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43,938,093 (GRCm39) missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43,935,629 (GRCm39) missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43,937,728 (GRCm39) missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43,937,110 (GRCm39) missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43,931,337 (GRCm39) missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43,935,918 (GRCm39) missense probably benign
IGL02929:Tdrd6 APN 17 43,940,604 (GRCm39) missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43,938,778 (GRCm39) missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43,938,153 (GRCm39) missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43,938,440 (GRCm39) missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43,936,323 (GRCm39) missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43,936,398 (GRCm39) missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43,938,855 (GRCm39) missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43,936,459 (GRCm39) missense probably damaging 1.00
Edward UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
eliza UTSW 17 43,939,053 (GRCm39) missense possibly damaging 0.90
Elizabeth UTSW 17 43,935,095 (GRCm39) missense probably benign 0.00
henry UTSW 17 43,939,050 (GRCm39) missense probably damaging 0.99
BB001:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
G1citation:Tdrd6 UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43,937,482 (GRCm39) missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43,928,052 (GRCm39) splice site probably benign
R0090:Tdrd6 UTSW 17 43,939,132 (GRCm39) missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43,935,199 (GRCm39) missense probably benign
R0463:Tdrd6 UTSW 17 43,936,452 (GRCm39) missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43,940,274 (GRCm39) missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43,939,050 (GRCm39) missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43,937,523 (GRCm39) missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43,937,512 (GRCm39) missense probably benign
R1483:Tdrd6 UTSW 17 43,938,498 (GRCm39) missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43,936,515 (GRCm39) missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43,936,515 (GRCm39) missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43,938,000 (GRCm39) missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43,938,000 (GRCm39) missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43,939,218 (GRCm39) missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43,937,442 (GRCm39) missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43,936,480 (GRCm39) missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43,935,696 (GRCm39) missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43,937,979 (GRCm39) missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43,937,358 (GRCm39) missense probably damaging 0.98
R2006:Tdrd6 UTSW 17 43,939,546 (GRCm39) missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43,938,933 (GRCm39) missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43,936,864 (GRCm39) missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43,940,626 (GRCm39) missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43,940,626 (GRCm39) missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43,939,645 (GRCm39) missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43,936,881 (GRCm39) missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43,935,007 (GRCm39) missense probably benign
R4676:Tdrd6 UTSW 17 43,938,501 (GRCm39) missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43,936,467 (GRCm39) missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43,935,218 (GRCm39) missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43,937,101 (GRCm39) missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43,936,966 (GRCm39) missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43,940,224 (GRCm39) missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43,937,299 (GRCm39) missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43,935,768 (GRCm39) missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43,939,302 (GRCm39) missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43,940,373 (GRCm39) missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43,939,788 (GRCm39) missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43,940,643 (GRCm39) missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43,940,643 (GRCm39) missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43,935,411 (GRCm39) missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43,937,229 (GRCm39) missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43,939,852 (GRCm39) missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43,935,423 (GRCm39) missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43,938,599 (GRCm39) missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43,936,065 (GRCm39) missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43,935,095 (GRCm39) missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43,936,984 (GRCm39) missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43,935,937 (GRCm39) missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43,938,817 (GRCm39) missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43,938,570 (GRCm39) missense not run
R7583:Tdrd6 UTSW 17 43,935,129 (GRCm39) missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43,938,817 (GRCm39) missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43,936,851 (GRCm39) missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43,935,730 (GRCm39) missense probably benign 0.00
R7924:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
R8002:Tdrd6 UTSW 17 43,940,710 (GRCm39) missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43,937,064 (GRCm39) missense probably damaging 0.99
R8231:Tdrd6 UTSW 17 43,933,026 (GRCm39) missense probably damaging 1.00
R8242:Tdrd6 UTSW 17 43,939,821 (GRCm39) missense probably damaging 1.00
R8542:Tdrd6 UTSW 17 43,935,783 (GRCm39) missense probably damaging 1.00
R8713:Tdrd6 UTSW 17 43,935,910 (GRCm39) missense probably benign 0.28
R9100:Tdrd6 UTSW 17 43,936,305 (GRCm39) missense possibly damaging 0.76
R9201:Tdrd6 UTSW 17 43,936,561 (GRCm39) missense probably benign 0.00
R9222:Tdrd6 UTSW 17 43,939,231 (GRCm39) missense probably damaging 1.00
R9369:Tdrd6 UTSW 17 43,936,217 (GRCm39) missense probably damaging 1.00
R9373:Tdrd6 UTSW 17 43,939,053 (GRCm39) missense possibly damaging 0.90
R9384:Tdrd6 UTSW 17 43,937,783 (GRCm39) missense probably benign 0.26
R9448:Tdrd6 UTSW 17 43,936,567 (GRCm39) missense probably benign
R9534:Tdrd6 UTSW 17 43,936,510 (GRCm39) missense probably benign 0.19
R9613:Tdrd6 UTSW 17 43,939,518 (GRCm39) missense probably damaging 0.99
X0065:Tdrd6 UTSW 17 43,936,884 (GRCm39) missense probably damaging 0.99
X0065:Tdrd6 UTSW 17 43,936,044 (GRCm39) missense possibly damaging 0.80
Z1088:Tdrd6 UTSW 17 43,937,409 (GRCm39) missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43,938,078 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGTCTAATCGGGTGAC -3'
(R):5'- GTACAATCCTGTTGCCTGGC -3'

Sequencing Primer
(F):5'- GCTCGGTAATAGCCATTTTCTTTC -3'
(R):5'- CTGACTGGTTTCTTCAGAGCCAG -3'
Posted On 2014-08-25