Incidental Mutation 'R2005:Apc'
ID 225460
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Name APC, WNT signaling pathway regulator
Synonyms Min, adenomatosis polyposis coli, CC1
MMRRC Submission 040014-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R2005 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34353977-34455605 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 34443962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000079362
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115781
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167136
Predicted Effect probably null
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,841,562 (GRCm39) A961V probably benign Het
Adcy10 A G 1: 165,352,591 (GRCm39) Y475C probably benign Het
Adgrb3 T C 1: 25,150,799 (GRCm39) M1145V probably benign Het
Akr1c21 A G 13: 4,624,214 (GRCm39) T23A probably damaging Het
Ankrd33b A T 15: 31,297,814 (GRCm39) S314R probably damaging Het
Atg9a T A 1: 75,162,635 (GRCm39) Q460L probably benign Het
Birc2 C T 9: 7,860,342 (GRCm39) C292Y probably damaging Het
Capn5 T C 7: 97,778,570 (GRCm39) I350V probably benign Het
Cc2d2a G A 5: 43,883,715 (GRCm39) probably null Het
Cdh22 T A 2: 165,022,843 (GRCm39) E76V probably damaging Het
Cdh8 T C 8: 99,760,103 (GRCm39) probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,898,919 (GRCm39) probably benign Het
Cfap54 T A 10: 92,720,630 (GRCm39) D2608V unknown Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 (GRCm39) N351Y possibly damaging Het
Cyp2c67 A T 19: 39,631,789 (GRCm39) M136K probably damaging Het
Ddx10 A G 9: 53,151,775 (GRCm39) probably null Het
Ddx47 A G 6: 134,995,084 (GRCm39) N92S probably benign Het
Ddx50 T A 10: 62,476,243 (GRCm39) H306L probably benign Het
Dnajc27 A G 12: 4,147,317 (GRCm39) T167A possibly damaging Het
Dscam T G 16: 96,840,120 (GRCm39) K162N probably benign Het
Eif4h G A 5: 134,656,531 (GRCm39) T53I probably benign Het
Elmo2 T C 2: 165,140,199 (GRCm39) N332S probably benign Het
Ergic3 A G 2: 155,853,028 (GRCm39) N157S possibly damaging Het
F2rl1 G T 13: 95,649,782 (GRCm39) R367S probably damaging Het
Fbxo36 G A 1: 84,877,790 (GRCm39) A151T probably benign Het
Foxf2 G T 13: 31,810,124 (GRCm39) R21L unknown Het
Gmip T A 8: 70,266,693 (GRCm39) H269Q probably benign Het
Gng4 T A 13: 13,980,751 (GRCm39) V32E probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Helz2 C T 2: 180,873,122 (GRCm39) R2396H probably benign Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Itgb3bp A C 4: 99,702,295 (GRCm39) N16K probably benign Het
Kcnt2 A G 1: 140,480,756 (GRCm39) M824V probably damaging Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mmp25 G A 17: 23,859,216 (GRCm39) R144W probably damaging Het
Mmrn1 A T 6: 60,953,068 (GRCm39) I450F possibly damaging Het
Mroh2b A T 15: 4,946,640 (GRCm39) K480M probably damaging Het
Nbn T A 4: 15,979,351 (GRCm39) D445E probably benign Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Or10ag56 T A 2: 87,139,792 (GRCm39) S240T probably benign Het
Or1e19 A T 11: 73,316,065 (GRCm39) V248E probably damaging Het
Or5d38 A G 2: 87,954,891 (GRCm39) L146P probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Pard3b A T 1: 62,184,050 (GRCm39) E183D probably benign Het
Pde10a G A 17: 9,147,923 (GRCm39) probably null Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Prdm13 T C 4: 21,685,695 (GRCm39) probably benign Het
Rc3h2 T A 2: 37,279,765 (GRCm39) K461* probably null Het
Reep2 C T 18: 34,978,674 (GRCm39) T117M probably damaging Het
Rhbdd1 A G 1: 82,318,531 (GRCm39) N138S probably benign Het
Rnf19a A T 15: 36,241,916 (GRCm39) F708I possibly damaging Het
Robo2 G A 16: 73,730,003 (GRCm39) H1069Y possibly damaging Het
Rpl9 C T 5: 65,546,878 (GRCm39) V112I probably benign Het
Sec16a A C 2: 26,329,092 (GRCm39) S974R probably benign Het
Sfrp5 A G 19: 42,187,275 (GRCm39) M265T probably benign Het
Skint7 T C 4: 111,842,047 (GRCm39) I305T probably benign Het
Slc6a7 T C 18: 61,134,713 (GRCm39) D454G possibly damaging Het
Slco6c1 A G 1: 97,009,214 (GRCm39) I407T probably damaging Het
Slfn8 A T 11: 82,894,976 (GRCm39) M610K probably damaging Het
Spidr A G 16: 15,865,913 (GRCm39) S299P probably damaging Het
Sptbn4 C T 7: 27,065,844 (GRCm39) W2034* probably null Het
Stard9 T A 2: 120,495,426 (GRCm39) F100L possibly damaging Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stc1 T C 14: 69,269,096 (GRCm39) probably null Het
Sun2 T C 15: 79,610,825 (GRCm39) E667G possibly damaging Het
Tacc2 T C 7: 130,333,280 (GRCm39) S511P probably damaging Het
Tasp1 T G 2: 139,819,598 (GRCm39) K202Q probably damaging Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tgds A G 14: 118,368,068 (GRCm39) V35A possibly damaging Het
Tubgcp6 G A 15: 88,988,369 (GRCm39) T860I probably benign Het
Twf1 C T 15: 94,483,328 (GRCm39) probably null Het
Vangl1 A G 3: 102,070,782 (GRCm39) S385P probably benign Het
Vmn2r117 A G 17: 23,696,618 (GRCm39) I263T probably damaging Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wnk4 T C 11: 101,154,716 (GRCm39) C302R probably damaging Het
Zfp395 A G 14: 65,626,334 (GRCm39) E191G possibly damaging Het
Zkscan17 A G 11: 59,383,042 (GRCm39) L302P probably damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34,449,979 (GRCm39) missense probably benign 0.01
IGL00898:Apc APN 18 34,450,147 (GRCm39) missense probably damaging 1.00
IGL01111:Apc APN 18 34,448,189 (GRCm39) missense possibly damaging 0.95
IGL01347:Apc APN 18 34,450,723 (GRCm39) missense probably damaging 1.00
IGL01375:Apc APN 18 34,446,707 (GRCm39) missense probably damaging 1.00
IGL01805:Apc APN 18 34,451,271 (GRCm39) missense probably benign 0.02
IGL01997:Apc APN 18 34,448,476 (GRCm39) missense probably benign 0.00
IGL02033:Apc APN 18 34,443,772 (GRCm39) missense probably damaging 1.00
IGL02323:Apc APN 18 34,448,863 (GRCm39) nonsense probably null
IGL02373:Apc APN 18 34,449,212 (GRCm39) missense probably damaging 1.00
IGL02379:Apc APN 18 34,431,798 (GRCm39) missense probably benign 0.45
IGL02456:Apc APN 18 34,446,935 (GRCm39) nonsense probably null
IGL02552:Apc APN 18 34,446,035 (GRCm39) missense possibly damaging 0.90
IGL02676:Apc APN 18 34,448,687 (GRCm39) missense probably damaging 1.00
IGL02756:Apc APN 18 34,447,588 (GRCm39) missense probably damaging 1.00
IGL02938:Apc APN 18 34,448,281 (GRCm39) missense probably damaging 0.98
IGL02974:Apc APN 18 34,401,436 (GRCm39) splice site probably benign
IGL03124:Apc APN 18 34,433,038 (GRCm39) missense probably damaging 0.98
IGL03201:Apc APN 18 34,445,429 (GRCm39) missense probably damaging 1.00
IGL03339:Apc APN 18 34,431,527 (GRCm39) missense probably damaging 1.00
FR4304:Apc UTSW 18 34,415,050 (GRCm39) intron probably benign
FR4342:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,058 (GRCm39) intron probably benign
FR4449:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4548:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
FR4737:Apc UTSW 18 34,415,052 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,057 (GRCm39) nonsense probably null
FR4976:Apc UTSW 18 34,415,053 (GRCm39) intron probably benign
FR4976:Apc UTSW 18 34,415,051 (GRCm39) intron probably benign
R0385:Apc UTSW 18 34,448,997 (GRCm39) missense probably damaging 1.00
R0535:Apc UTSW 18 34,394,125 (GRCm39) missense probably damaging 1.00
R0561:Apc UTSW 18 34,446,356 (GRCm39) missense possibly damaging 0.94
R0590:Apc UTSW 18 34,449,283 (GRCm39) nonsense probably null
R0626:Apc UTSW 18 34,451,507 (GRCm39) missense probably damaging 1.00
R0991:Apc UTSW 18 34,449,160 (GRCm39) missense probably damaging 1.00
R1564:Apc UTSW 18 34,448,202 (GRCm39) missense probably benign 0.00
R1663:Apc UTSW 18 34,401,378 (GRCm39) missense probably damaging 0.98
R1737:Apc UTSW 18 34,450,075 (GRCm39) missense probably damaging 1.00
R1739:Apc UTSW 18 34,445,371 (GRCm39) missense probably damaging 1.00
R1835:Apc UTSW 18 34,450,130 (GRCm39) missense probably damaging 1.00
R1887:Apc UTSW 18 34,405,521 (GRCm39) missense probably damaging 1.00
R1957:Apc UTSW 18 34,450,388 (GRCm39) missense probably damaging 1.00
R1974:Apc UTSW 18 34,433,057 (GRCm39) missense possibly damaging 0.62
R2013:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2014:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2015:Apc UTSW 18 34,448,644 (GRCm39) missense probably damaging 0.98
R2017:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R2056:Apc UTSW 18 34,449,481 (GRCm39) missense probably damaging 1.00
R2108:Apc UTSW 18 34,402,282 (GRCm39) missense probably damaging 1.00
R2120:Apc UTSW 18 34,409,654 (GRCm39) missense probably damaging 1.00
R2131:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2133:Apc UTSW 18 34,445,098 (GRCm39) missense possibly damaging 0.51
R2291:Apc UTSW 18 34,445,544 (GRCm39) missense probably benign 0.45
R2332:Apc UTSW 18 34,450,112 (GRCm39) missense possibly damaging 0.50
R2360:Apc UTSW 18 34,394,179 (GRCm39) missense probably damaging 1.00
R2407:Apc UTSW 18 34,447,315 (GRCm39) missense possibly damaging 0.77
R2507:Apc UTSW 18 34,449,590 (GRCm39) missense possibly damaging 0.77
R2940:Apc UTSW 18 34,409,723 (GRCm39) missense probably damaging 1.00
R3404:Apc UTSW 18 34,446,655 (GRCm39) missense probably benign 0.00
R3411:Apc UTSW 18 34,402,312 (GRCm39) splice site probably benign
R3778:Apc UTSW 18 34,446,134 (GRCm39) missense probably damaging 1.00
R3826:Apc UTSW 18 34,412,388 (GRCm39) missense possibly damaging 0.93
R4599:Apc UTSW 18 34,451,040 (GRCm39) nonsense probably null
R4611:Apc UTSW 18 34,451,618 (GRCm39) missense probably damaging 1.00
R4664:Apc UTSW 18 34,431,647 (GRCm39) missense probably damaging 0.98
R4969:Apc UTSW 18 34,445,971 (GRCm39) nonsense probably null
R5007:Apc UTSW 18 34,446,016 (GRCm39) missense probably damaging 1.00
R5066:Apc UTSW 18 34,449,158 (GRCm39) missense probably damaging 1.00
R5112:Apc UTSW 18 34,449,162 (GRCm39) nonsense probably null
R5259:Apc UTSW 18 34,447,343 (GRCm39) missense probably benign 0.29
R5440:Apc UTSW 18 34,354,213 (GRCm39) unclassified probably benign
R5508:Apc UTSW 18 34,431,633 (GRCm39) missense probably damaging 0.97
R5512:Apc UTSW 18 34,443,962 (GRCm39) critical splice donor site probably benign
R5850:Apc UTSW 18 34,451,116 (GRCm39) missense possibly damaging 0.94
R5951:Apc UTSW 18 34,450,199 (GRCm39) missense possibly damaging 0.89
R5966:Apc UTSW 18 34,354,140 (GRCm39) utr 5 prime probably benign
R6081:Apc UTSW 18 34,423,164 (GRCm39) missense possibly damaging 0.93
R6116:Apc UTSW 18 34,449,508 (GRCm39) missense probably damaging 1.00
R6351:Apc UTSW 18 34,445,265 (GRCm39) missense probably damaging 1.00
R6354:Apc UTSW 18 34,445,581 (GRCm39) missense probably benign 0.02
R6467:Apc UTSW 18 34,402,252 (GRCm39) missense probably benign 0.22
R6974:Apc UTSW 18 34,431,480 (GRCm39) missense possibly damaging 0.65
R7027:Apc UTSW 18 34,445,129 (GRCm39) missense probably damaging 1.00
R7096:Apc UTSW 18 34,449,010 (GRCm39) missense probably damaging 1.00
R7289:Apc UTSW 18 34,448,324 (GRCm39) missense probably damaging 1.00
R7439:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7441:Apc UTSW 18 34,445,126 (GRCm39) missense probably damaging 1.00
R7534:Apc UTSW 18 34,450,015 (GRCm39) missense probably damaging 1.00
R7685:Apc UTSW 18 34,447,261 (GRCm39) missense probably damaging 1.00
R7814:Apc UTSW 18 34,405,592 (GRCm39) missense probably damaging 0.98
R7954:Apc UTSW 18 34,447,321 (GRCm39) missense probably damaging 0.99
R8352:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8452:Apc UTSW 18 34,445,804 (GRCm39) missense possibly damaging 0.54
R8497:Apc UTSW 18 34,446,083 (GRCm39) missense possibly damaging 0.81
R8545:Apc UTSW 18 34,450,084 (GRCm39) missense possibly damaging 0.94
R8554:Apc UTSW 18 34,445,999 (GRCm39) missense probably damaging 1.00
R8955:Apc UTSW 18 34,401,370 (GRCm39) missense probably damaging 1.00
R9014:Apc UTSW 18 34,354,074 (GRCm39) start gained probably benign
R9061:Apc UTSW 18 34,446,251 (GRCm39) missense probably damaging 1.00
R9147:Apc UTSW 18 34,450,710 (GRCm39) missense probably damaging 1.00
R9318:Apc UTSW 18 34,447,040 (GRCm39) missense possibly damaging 0.69
R9521:Apc UTSW 18 34,445,738 (GRCm39) missense probably benign 0.24
R9546:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9547:Apc UTSW 18 34,445,311 (GRCm39) missense possibly damaging 0.86
R9557:Apc UTSW 18 34,451,412 (GRCm39) missense probably damaging 1.00
R9592:Apc UTSW 18 34,443,823 (GRCm39) nonsense probably null
R9675:Apc UTSW 18 34,449,247 (GRCm39) missense probably damaging 1.00
R9736:Apc UTSW 18 34,450,823 (GRCm39) missense probably damaging 1.00
R9792:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9793:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
R9795:Apc UTSW 18 34,447,628 (GRCm39) missense probably damaging 1.00
RF046:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
RF063:Apc UTSW 18 34,415,062 (GRCm39) critical splice donor site probably benign
X0021:Apc UTSW 18 34,445,161 (GRCm39) missense probably damaging 1.00
X0025:Apc UTSW 18 34,445,429 (GRCm39) missense probably damaging 1.00
Z1088:Apc UTSW 18 34,446,220 (GRCm39) nonsense probably null
Z1177:Apc UTSW 18 34,447,516 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACACTGCACTGAGAATAAGGCTG -3'
(R):5'- TGGCTGGATTTCTCAACTACC -3'

Sequencing Primer
(F):5'- AATAAGGCTGACATCTGTGCTG -3'
(R):5'- GCTGGATTTCTCAACTACCATATTTG -3'
Posted On 2014-08-25