Incidental Mutation 'R2040:Ptpn18'
ID 225469
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Name protein tyrosine phosphatase, non-receptor type 18
Synonyms PTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1
MMRRC Submission 040047-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R2040 (G1)
Quality Score 180
Status Validated
Chromosome 1
Chromosomal Location 34459762-34475733 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34470219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 165 (Q165R)
Ref Sequence ENSEMBL: ENSMUSP00000139885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]
AlphaFold Q61152
Predicted Effect probably damaging
Transcript: ENSMUST00000027302
AA Change: Q189R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: Q189R

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188884
Predicted Effect probably benign
Transcript: ENSMUST00000188972
Predicted Effect probably damaging
Transcript: ENSMUST00000190122
AA Change: Q165R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126
AA Change: Q165R

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191357
Meta Mutation Damage Score 0.6635 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Pam T C 1: 97,864,442 E418G possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sept7 G A 9: 25,288,236 A144T possibly damaging Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vegfb T A 19: 6,986,039 H119L possibly damaging Het
Vmn2r111 T A 17: 22,548,414 I701F probably damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Ythdc2 T A 18: 44,855,174 Y16* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34463119 missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34459817 utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34471908 missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34470257 splice site probably null
R0848:Ptpn18 UTSW 1 34462702 missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34463506 critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34463109 missense probably damaging 1.00
R2113:Ptpn18 UTSW 1 34471661 missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34471692 nonsense probably null
R4061:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34472930 missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34462742 missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34472960 missense probably benign
R4626:Ptpn18 UTSW 1 34471792 splice site probably null
R4978:Ptpn18 UTSW 1 34469813 intron probably benign
R5260:Ptpn18 UTSW 1 34463510 splice site probably benign
R5335:Ptpn18 UTSW 1 34463178 missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34471663 missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34471563 splice site probably benign
R7038:Ptpn18 UTSW 1 34459825 start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34472846 missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34462811 critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34472192 critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34473335 missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34462750 missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34473364 missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34469905 splice site probably null
R8543:Ptpn18 UTSW 1 34472148 missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34472190 missense probably null 1.00
R8831:Ptpn18 UTSW 1 34472190 missense probably null 1.00
R8858:Ptpn18 UTSW 1 34463115 missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34463130 missense probably benign 0.23
R8924:Ptpn18 UTSW 1 34459885 missense probably benign 0.02
R9657:Ptpn18 UTSW 1 34473392 missense possibly damaging 0.87
X0065:Ptpn18 UTSW 1 34469891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACACAATGGACTTGCTTG -3'
(R):5'- GCTCCTAGCCACAACTGTTC -3'

Sequencing Primer
(F):5'- ACACAATGGACTTGCTTGTCTCTATG -3'
(R):5'- AGCCACAACTGTTCTCCCTTG -3'
Posted On 2014-08-25