Incidental Mutation 'R2040:Pam'
ID225471
Institutional Source Beutler Lab
Gene Symbol Pam
Ensembl Gene ENSMUSG00000026335
Gene Namepeptidylglycine alpha-amidating monooxygenase
SynonymsPHM
MMRRC Submission 040047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2040 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location97795114-98095646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97864442 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 418 (E418G)
Ref Sequence ENSEMBL: ENSMUSP00000095228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058762
AA Change: E418G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335
AA Change: E418G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 62 178 7.8e-27 PFAM
Pfam:Cu2_monoox_C 199 346 6.2e-47 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.7e-8 PFAM
Pfam:NHL 782 809 2.8e-7 PFAM
transmembrane domain 870 892 N/A INTRINSIC
low complexity region 908 930 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097625
AA Change: E418G

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335
AA Change: E418G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.7e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.4e-54 PFAM
Pfam:NHL 581 608 9.4e-9 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.2e-8 PFAM
Pfam:NHL 782 809 3.6e-8 PFAM
transmembrane domain 869 891 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159841
SMART Domains Protein: ENSMUSP00000124479
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
Pfam:Cu2_monoox_C 1 53 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161071
Predicted Effect probably benign
Transcript: ENSMUST00000161567
SMART Domains Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.2e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.2e-54 PFAM
Pfam:NHL 475 502 8.3e-9 PFAM
Pfam:NHL 527 556 1.9e-8 PFAM
low complexity region 567 574 N/A INTRINSIC
Pfam:NHL 580 608 1.9e-8 PFAM
Pfam:NHL 676 703 3.2e-8 PFAM
transmembrane domain 764 786 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 844 863 N/A INTRINSIC
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpn18 A G 1: 34,470,219 Q165R probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sept7 G A 9: 25,288,236 A144T possibly damaging Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vegfb T A 19: 6,986,039 H119L possibly damaging Het
Vmn2r111 T A 17: 22,548,414 I701F probably damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Ythdc2 T A 18: 44,855,174 Y16* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Pam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pam APN 1 97924427 splice site probably benign
IGL00485:Pam APN 1 97822953 missense possibly damaging 0.78
IGL00597:Pam APN 1 97834444 missense probably benign 0.02
IGL01585:Pam APN 1 97864472 missense probably damaging 0.99
IGL01776:Pam APN 1 97885600 critical splice donor site probably null
IGL01981:Pam APN 1 97834441 missense probably damaging 1.00
IGL02152:Pam APN 1 97840749 missense probably damaging 1.00
IGL02605:Pam APN 1 97840339 missense possibly damaging 0.85
IGL02882:Pam APN 1 97840367 missense probably damaging 1.00
IGL03142:Pam APN 1 97894386 missense probably damaging 1.00
IGL03409:Pam APN 1 97864329 missense probably benign 0.04
R0084:Pam UTSW 1 97896049 missense probably benign 0.01
R0200:Pam UTSW 1 97894401 splice site probably null
R0520:Pam UTSW 1 97884195 missense probably benign 0.00
R0734:Pam UTSW 1 97864362 nonsense probably null
R1881:Pam UTSW 1 97923151 missense probably benign 0.06
R2106:Pam UTSW 1 97831490 missense probably damaging 1.00
R2913:Pam UTSW 1 97923129 missense probably damaging 1.00
R3148:Pam UTSW 1 97895678 missense possibly damaging 0.84
R3618:Pam UTSW 1 97834432 missense probably damaging 1.00
R3619:Pam UTSW 1 97834432 missense probably damaging 1.00
R3847:Pam UTSW 1 97854756 intron probably benign
R3848:Pam UTSW 1 97854756 intron probably benign
R3849:Pam UTSW 1 97854756 intron probably benign
R4128:Pam UTSW 1 97834468 missense probably damaging 0.99
R4231:Pam UTSW 1 97884124 critical splice donor site probably null
R4233:Pam UTSW 1 97864394 missense possibly damaging 0.86
R4404:Pam UTSW 1 97854721 intron probably benign
R4536:Pam UTSW 1 97844699 nonsense probably null
R4738:Pam UTSW 1 97923132 missense probably damaging 1.00
R5054:Pam UTSW 1 97821917 missense probably damaging 1.00
R5501:Pam UTSW 1 97840365 nonsense probably null
R5572:Pam UTSW 1 97854744 intron probably benign
R5654:Pam UTSW 1 97864398 missense probably benign 0.00
R5659:Pam UTSW 1 97842299 missense probably damaging 1.00
R6112:Pam UTSW 1 97834468 missense probably damaging 0.99
R6513:Pam UTSW 1 97838027 missense possibly damaging 0.60
R6696:Pam UTSW 1 97885727 missense possibly damaging 0.79
R6743:Pam UTSW 1 97896049 missense probably benign 0.01
R6833:Pam UTSW 1 97837992 missense probably damaging 0.99
R6834:Pam UTSW 1 97837992 missense probably damaging 0.99
R7098:Pam UTSW 1 97898347 missense probably benign
R7117:Pam UTSW 1 97977116 start gained probably benign
R7152:Pam UTSW 1 97885740 missense probably damaging 1.00
R7172:Pam UTSW 1 97834478 missense probably benign 0.10
R7206:Pam UTSW 1 97896032 missense probably damaging 1.00
R7262:Pam UTSW 1 97854723 missense
R7434:Pam UTSW 1 97975790 nonsense probably null
R7466:Pam UTSW 1 97842247 missense probably damaging 1.00
R7513:Pam UTSW 1 97853185 missense possibly damaging 0.88
R7790:Pam UTSW 1 97821847 missense probably damaging 1.00
R8054:Pam UTSW 1 97840389 missense probably damaging 1.00
R8093:Pam UTSW 1 97885632 missense probably damaging 1.00
R8183:Pam UTSW 1 97834474 missense probably benign 0.08
R8404:Pam UTSW 1 97895633 missense probably damaging 1.00
R8734:Pam UTSW 1 97834402 splice site probably benign
Z1176:Pam UTSW 1 97934723 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGAAGGATAGAGCTCTG -3'
(R):5'- AGAACAACCTTGCTTCTCACTC -3'

Sequencing Primer
(F):5'- TGCTCTCAGCTGGCCTCAAG -3'
(R):5'- TTCCAAGCTGCTAGGAGA -3'
Posted On2014-08-25