Mutagenetix > Incidental Mutations

Incidental Mutation 'R0145:Tgm5'

22548

Institutional Source

Beutler Lab

Gene Symbol

Tgm5

Ensembl Gene

ENSMUSG00000053675

Gene Name

transglutaminase 5

Synonyms

2310007C07Rik, TGx

MMRRC Submission

038430-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R0145 (G1) of strain 722

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

121046111-121085841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121077581 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 38 (V38A)

Ref Sequence

ENSEMBL: ENSMUSP00000028721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028721]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028721
AA Change: V38A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: V38A

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	11	127	1.4e-31	PFAM
TGc	275	368	1.86e-49	SMART
Pfam:Transglut_C	511	610	2.5e-23	PFAM
Pfam:Transglut_C	624	722	1.8e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142674

Meta Mutation Damage Score

0.5137

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 93.7%
20x: 82.1%

Validation Efficiency

96% (109/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	G	10: 100,601,921	E64G	probably damaging	Het
1810043G02Rik	T	C	10: 77,983,556	S196P	probably benign	Het
4931408C20Rik	A	G	1: 26,687,332	M32T	probably benign	Het
Actr6	A	T	10: 89,728,178	Y77*	probably null	Het
Aldoart1	A	T	4: 72,851,339	S411T	probably benign	Het
Aqp1	C	T	6: 55,346,687	R234C	probably damaging	Het
Arsb	G	A	13: 93,862,287	G368R	possibly damaging	Het
Asxl3	G	A	18: 22,453,605	A151T	probably damaging	Het
Bcas3	T	C	11: 85,359,610		probably benign	Het
Bmpr2	AACACA	AACA	1: 59,867,580		probably null	Het
Bst1	A	G	5: 43,819,072	Y49C	probably damaging	Het
Btrc	T	A	19: 45,423,173	L12Q	probably damaging	Het
Cd248	T	C	19: 5,069,023	F300L	possibly damaging	Het
Cdk11b	G	T	4: 155,641,619		probably benign	Het
Cfap44	A	T	16: 44,468,372	D1495V	probably damaging	Het
Chil3	T	A	3: 106,160,478	I124F	probably damaging	Het
Cnot2	A	T	10: 116,517,368	S63T	possibly damaging	Het
Cox8a	G	T	19: 7,215,418	H61N	probably benign	Het
Cpne9	T	C	6: 113,300,601	V427A	probably damaging	Het
Ctsll3	C	A	13: 60,798,595	G301C	probably damaging	Het
Cubn	T	A	2: 13,306,432	D3094V	probably damaging	Het
Cyba	A	T	8: 122,427,238	M65K	possibly damaging	Het
Cyp4f39	T	A	17: 32,486,960	S342T	possibly damaging	Het
Daam2	T	C	17: 49,480,778	I436V	probably benign	Het
Daglb	T	C	5: 143,474,608		probably benign	Het
Dnah7b	T	G	1: 46,223,178	L2067R	probably damaging	Het
Ep300	T	C	15: 81,616,127		probably null	Het
Esm1	A	G	13: 113,216,696	N171D	probably damaging	Het
Fbxl2	T	C	9: 113,985,325	E266G	probably damaging	Het
Ficd	G	T	5: 113,738,819	A352S	probably damaging	Het
H2-Q2	A	G	17: 35,345,176	D302G	probably benign	Het
Hacd3	A	T	9: 65,004,242		probably benign	Het
Kbtbd6	T	A	14: 79,453,024	N386K	probably benign	Het
Lct	T	C	1: 128,327,895	M137V	probably benign	Het
Lilr4b	T	G	10: 51,484,518	N176K	probably benign	Het
Macf1	T	A	4: 123,387,397	H4340L	probably damaging	Het
Mcidas	A	G	13: 112,994,372	D77G	probably damaging	Het
Mmrn1	C	A	6: 60,973,010	Q315K	probably damaging	Het
Mon2	C	A	10: 123,013,512	L1294F	possibly damaging	Het
Muc5ac	A	G	7: 141,795,275	T483A	possibly damaging	Het
Nacc1	T	C	8: 84,674,875		probably benign	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Ngef	A	G	1: 87,540,648		probably benign	Het
Nol8	C	T	13: 49,662,447	A677V	possibly damaging	Het
Ogfod3	A	T	11: 121,195,070		probably benign	Het
Olfr1104	A	C	2: 87,021,790	Y251*	probably null	Het
Olfr767	A	T	10: 129,079,363	V200E	probably damaging	Het
Parpbp	T	C	10: 88,093,009	Y523C	possibly damaging	Het
Pik3cg	C	A	12: 32,204,322	L555F	probably benign	Het
Pkp3	T	G	7: 141,089,763		probably null	Het
Pole	G	T	5: 110,324,425	R1518L	probably damaging	Het
Prkab1	T	C	5: 116,018,085		probably benign	Het
Prrc2a	T	C	17: 35,155,820	T1285A	probably benign	Het
Pus1	C	A	5: 110,774,854	V222L	probably benign	Het
Rab11fip1	A	G	8: 27,143,324	L1118P	probably damaging	Het
Ranbp2	T	A	10: 58,480,046	I2196N	probably damaging	Het
Rims3	T	C	4: 120,887,026	L151P	probably damaging	Het
Rnf130	A	G	11: 50,071,219	D164G	possibly damaging	Het
Rps6ka2	C	A	17: 7,262,186	L293I	probably benign	Het
Ruvbl1	A	G	6: 88,484,459	T269A	possibly damaging	Het
Sema4a	A	T	3: 88,451,422	I10N	probably damaging	Het
Serpinb6e	A	T	13: 33,841,060	S83T	probably benign	Het
Slc12a9	C	A	5: 137,315,288	W803L	probably damaging	Het
Slc3a2	A	G	19: 8,708,073	S188P	probably damaging	Het
Slc7a13	G	A	4: 19,818,782		probably benign	Het
Spg20	A	T	3: 55,127,671	K493*	probably null	Het
Sun1	T	C	5: 139,241,411	V574A	probably damaging	Het
Supt6	A	G	11: 78,208,236	V1603A	probably benign	Het
Tm6sf2	T	C	8: 70,077,868		probably benign	Het
Tnfaip2	T	A	12: 111,445,858	V231E	possibly damaging	Het
Tube1	T	A	10: 39,145,602	M281K	possibly damaging	Het
Tubgcp3	A	G	8: 12,657,561	Y143H	probably benign	Het
Tyrp1	A	G	4: 80,840,778	Y296C	probably damaging	Het
Utp4	A	G	8: 106,894,669	N26S	probably benign	Het
Vgf	T	A	5: 137,031,482		probably benign	Het
Zfat	T	C	15: 68,187,099	K196E	possibly damaging	Het
Zfp366	G	T	13: 99,229,540	S403I	probably damaging	Het
Zfp462	G	A	4: 55,010,529	G832R	probably damaging	Het
Zfp955a	T	A	17: 33,242,456	Q234L	probably damaging	Het
Zufsp	T	C	10: 33,943,713	T202A	probably damaging	Het

Other mutations in Tgm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Tgm5	APN	2	121071496	missense	probably benign	0.01
IGL01148:Tgm5	APN	2	121046675	splice site	probably null
IGL01284:Tgm5	APN	2	121052547	missense	possibly damaging	0.94
IGL01370:Tgm5	APN	2	121053537	missense	probably benign	0.03
IGL01545:Tgm5	APN	2	121052808	missense	probably damaging	1.00
IGL01547:Tgm5	APN	2	121049202	splice site	probably benign
IGL01998:Tgm5	APN	2	121052439	missense	probably damaging	1.00
IGL02577:Tgm5	APN	2	121077603	missense	probably benign	0.01
IGL02636:Tgm5	APN	2	121076796	missense	probably damaging	0.99
PIT4283001:Tgm5	UTSW	2	121071585	missense	possibly damaging	0.48
R0001:Tgm5	UTSW	2	121077646	missense	probably damaging	1.00
R0013:Tgm5	UTSW	2	121076882	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0117:Tgm5	UTSW	2	121075102	critical splice donor site	probably null
R0356:Tgm5	UTSW	2	121053574	missense	probably damaging	1.00
R0410:Tgm5	UTSW	2	121077558	missense	possibly damaging	0.46
R0519:Tgm5	UTSW	2	121048895	missense	probably damaging	1.00
R1674:Tgm5	UTSW	2	121071544	missense	possibly damaging	0.60
R1773:Tgm5	UTSW	2	121077650	missense	possibly damaging	0.67
R1864:Tgm5	UTSW	2	121075218	missense	probably damaging	1.00
R2276:Tgm5	UTSW	2	121048823	splice site	probably benign
R2511:Tgm5	UTSW	2	121076948	missense	possibly damaging	0.62
R4180:Tgm5	UTSW	2	121076961	missense	probably benign	0.13
R4230:Tgm5	UTSW	2	121070735	missense	probably damaging	1.00
R4801:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R4802:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R5840:Tgm5	UTSW	2	121085660	critical splice donor site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R7064:Tgm5	UTSW	2	121053514	missense	probably benign	0.04
R7102:Tgm5	UTSW	2	121046498	missense	possibly damaging	0.89
R7114:Tgm5	UTSW	2	121048496	nonsense	probably null
R7178:Tgm5	UTSW	2	121085768	start gained	probably benign
R7748:Tgm5	UTSW	2	121052808	missense	probably damaging	1.00
RF022:Tgm5	UTSW	2	121071611	missense	probably damaging	1.00
V3553:Tgm5	UTSW	2	121071502	missense	probably damaging	1.00
X0065:Tgm5	UTSW	2	121070839	missense	probably damaging	1.00
Z1177:Tgm5	UTSW	2	121052451	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGAATACTGCCCGAGTCCC -3'
(R):5'- TGAACAAAACTGGACTGGCCTTCAC -3'

Sequencing Primer
(F):5'- cacacacccccacacac -3'
(R):5'- ACTGGCCTTCACAACCCTG -3'

Posted On

2013-04-16