Incidental Mutation 'R2006:Pik3c2b'
ID 225480
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 040015-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R2006 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 132994282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 82 (R82L)
Ref Sequence ENSEMBL: ENSMUSP00000115469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect possibly damaging
Transcript: ENSMUST00000077730
AA Change: R82L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: R82L

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145153
Predicted Effect probably damaging
Transcript: ENSMUST00000153707
AA Change: R82L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: R82L

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,204,275 (GRCm39) F333L probably benign Het
Abcc2 T A 19: 43,793,500 (GRCm39) F384Y probably damaging Het
Acr C T 15: 89,458,404 (GRCm39) P362S probably benign Het
Acss3 T C 10: 106,798,871 (GRCm39) D484G possibly damaging Het
Actrt1 A G X: 45,418,593 (GRCm39) T203A probably benign Het
Agtpbp1 A T 13: 59,648,135 (GRCm39) C562S probably benign Het
Ahnak A G 19: 8,984,439 (GRCm39) K1908E probably damaging Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Apaf1 A T 10: 90,897,634 (GRCm39) I283N probably damaging Het
Bbx G A 16: 50,044,758 (GRCm39) T493M possibly damaging Het
Best2 C T 8: 85,739,818 (GRCm39) probably null Het
C4bp C A 1: 130,575,769 (GRCm39) E75* probably null Het
Calr3 A T 8: 73,188,695 (GRCm39) V144D probably damaging Het
Capn1 C T 19: 6,041,613 (GRCm39) G632D probably damaging Het
Catsper2 C A 2: 121,236,838 (GRCm39) E270* probably null Het
Ccdc110 A T 8: 46,396,349 (GRCm39) I747F probably damaging Het
Ccdc15 T A 9: 37,226,768 (GRCm39) D389V possibly damaging Het
Cd226 A G 18: 89,265,435 (GRCm39) I125V probably benign Het
Crb2 A T 2: 37,673,446 (GRCm39) D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 3,902,617 (GRCm39) probably benign Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Dab1 T C 4: 104,462,522 (GRCm39) I32T probably damaging Het
Daw1 T C 1: 83,169,066 (GRCm39) V181A probably damaging Het
Dlg2 G A 7: 91,614,825 (GRCm39) E255K possibly damaging Het
Dnah10 T A 5: 124,906,651 (GRCm39) D4170E possibly damaging Het
Dnah12 A G 14: 26,536,416 (GRCm39) T2111A possibly damaging Het
Dock10 T C 1: 80,527,506 (GRCm39) Y1081C possibly damaging Het
Dscam T C 16: 96,621,112 (GRCm39) Y532C probably damaging Het
Fam83c T C 2: 155,672,223 (GRCm39) D404G probably benign Het
Fam83g A G 11: 61,593,801 (GRCm39) N445S possibly damaging Het
Ghr C T 15: 3,357,464 (GRCm39) C268Y probably damaging Het
Gm8444 T C 15: 81,727,775 (GRCm39) probably benign Het
Gp6 T A 7: 4,387,988 (GRCm39) K160N probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Gtf3c2 C A 5: 31,325,440 (GRCm39) G450C probably damaging Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Il31ra T G 13: 112,666,890 (GRCm39) Y396S probably damaging Het
Insig1 A G 5: 28,276,464 (GRCm39) N10S probably benign Het
Kcnh2 C A 5: 24,531,568 (GRCm39) G448C probably damaging Het
L1td1 C T 4: 98,621,726 (GRCm39) S96L possibly damaging Het
Mapre3 A T 5: 31,019,168 (GRCm39) N4I probably damaging Het
Mblac2 T A 13: 81,859,860 (GRCm39) D70E probably benign Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mpg A G 11: 32,181,840 (GRCm39) I283V probably benign Het
Mrtfb G T 16: 13,199,440 (GRCm39) E98* probably null Het
Mybpc1 C A 10: 88,381,921 (GRCm39) A576S probably damaging Het
Myo1h T G 5: 114,499,140 (GRCm39) V129G probably damaging Het
Nars1 A T 18: 64,638,099 (GRCm39) V285E probably damaging Het
Nbas T A 12: 13,464,742 (GRCm39) probably null Het
Neb T C 2: 52,089,456 (GRCm39) D5172G probably null Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Nyap1 T C 5: 137,733,953 (GRCm39) H360R possibly damaging Het
Nyx A G X: 13,352,974 (GRCm39) E276G probably damaging Het
Or10ag59 T A 2: 87,405,536 (GRCm39) M36K probably benign Het
Or1e1 G T 11: 73,245,518 (GRCm39) C313F probably benign Het
Or2l13b A G 16: 19,349,455 (GRCm39) Y72H probably benign Het
Or2w6 T C 13: 21,842,642 (GRCm39) T284A possibly damaging Het
Or4c1 A G 2: 89,133,160 (GRCm39) Y259H possibly damaging Het
Or4c118 A T 2: 88,975,241 (GRCm39) V42E probably benign Het
Or5v1b C T 17: 37,841,597 (GRCm39) S243F probably damaging Het
Or7e174 A T 9: 20,012,165 (GRCm39) M37L probably benign Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Or8g23 T A 9: 38,971,729 (GRCm39) T78S probably damaging Het
Paf1 C A 7: 28,095,193 (GRCm39) probably null Het
Pcsk5 T C 19: 17,455,280 (GRCm39) D1050G probably benign Het
Pgap1 A G 1: 54,590,220 (GRCm39) S73P possibly damaging Het
Phtf1 G A 3: 103,911,799 (GRCm39) probably null Het
Pik3ca T C 3: 32,504,206 (GRCm39) L632P probably damaging Het
Plau G T 14: 20,888,760 (GRCm39) probably null Het
Pld4 A T 12: 112,734,923 (GRCm39) Q460L possibly damaging Het
Prdm2 T A 4: 142,858,447 (GRCm39) Q1614H possibly damaging Het
Ptprq C T 10: 107,502,407 (GRCm39) G837D probably damaging Het
Rad9b A G 5: 122,477,842 (GRCm39) V178A possibly damaging Het
Rfc1 G T 5: 65,468,397 (GRCm39) Y105* probably null Het
Sardh G A 2: 27,118,351 (GRCm39) R460C probably damaging Het
Scn5a C A 9: 119,365,546 (GRCm39) R367L probably damaging Het
Sdcbp A T 4: 6,386,536 (GRCm39) I137L probably benign Het
Shmt2 A G 10: 127,355,029 (GRCm39) V273A probably benign Het
Slc5a9 G T 4: 111,737,423 (GRCm39) P612H probably benign Het
Slitrk4 TTGT TT X: 63,314,294 (GRCm39) probably null Het
Slitrk4 TG T X: 63,314,295 (GRCm39) probably null Het
Spata1 A T 3: 146,199,438 (GRCm39) S9T probably benign Het
Syn3 T C 10: 85,909,097 (GRCm39) T328A probably benign Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tekt5 T C 16: 10,213,070 (GRCm39) I72V probably benign Het
Ticrr T C 7: 79,343,821 (GRCm39) S1229P possibly damaging Het
Tlr6 T C 5: 65,110,748 (GRCm39) S720G probably damaging Het
Tmem156 T A 5: 65,237,294 (GRCm39) D87V probably damaging Het
Togaram1 T A 12: 65,065,914 (GRCm39) D1639E probably damaging Het
Ucn2 A G 9: 108,815,430 (GRCm39) K64R probably benign Het
Vmn2r57 T A 7: 41,098,001 (GRCm39) Y22F probably benign Het
Vwa1 T C 4: 155,855,307 (GRCm39) T269A probably benign Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wdr20 T C 12: 110,760,002 (GRCm39) V296A probably damaging Het
Xxylt1 A T 16: 30,869,586 (GRCm39) H171Q probably damaging Het
Yju2 C T 17: 56,271,543 (GRCm39) Q155* probably null Het
Zfp275 A G X: 72,396,841 (GRCm39) T118A possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTCCACTCAGGGCAATG -3'
(R):5'- CAAAGAGCATCTCCCCTCTGAG -3'

Sequencing Primer
(F):5'- CCGCAAAGAGCTGGCTATG -3'
(R):5'- CCTCTGAGCCATCAAAAATATAGAG -3'
Posted On 2014-08-25