Mutagenetix > Incidental Mutation

Incidental Mutation 'R2006:Pik3c2b'

225480

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

040015-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R2006 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 133066544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 82 (R82L)

Ref Sequence

ENSEMBL: ENSMUSP00000115469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]

AlphaFold

E9QAN8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077730
AA Change: R82L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: R82L

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145153

Predicted Effect

probably damaging
Transcript: ENSMUST00000153707
AA Change: R82L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: R82L

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186515

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,313,449	F333L	probably benign	Het
Abcc2	T	A	19: 43,805,061	F384Y	probably damaging	Het
Acr	C	T	15: 89,574,201	P362S	probably benign	Het
Acss3	T	C	10: 106,963,010	D484G	possibly damaging	Het
Actrt1	A	G	X: 46,329,716	T203A	probably benign	Het
Agtpbp1	A	T	13: 59,500,321	C562S	probably benign	Het
Ahnak	A	G	19: 9,007,075	K1908E	probably damaging	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Apaf1	A	T	10: 91,061,772	I283N	probably damaging	Het
Bbx	G	A	16: 50,224,395	T493M	possibly damaging	Het
Best2	C	T	8: 85,013,189		probably null	Het
C4bp	C	A	1: 130,648,032	E75*	probably null	Het
Calr3	A	T	8: 72,434,851	V144D	probably damaging	Het
Capn1	C	T	19: 5,991,583	G632D	probably damaging	Het
Catsper2	C	A	2: 121,406,357	E270*	probably null	Het
Ccdc110	A	T	8: 45,943,312	I747F	probably damaging	Het
Ccdc15	T	A	9: 37,315,472	D389V	possibly damaging	Het
Ccdc94	C	T	17: 55,964,543	Q155*	probably null	Het
Cd226	A	G	18: 89,247,311	I125V	probably benign	Het
Crb2	A	T	2: 37,783,434	D114V	probably damaging	Het
Crebbp	TTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTG	16: 4,084,753		probably benign	Het
Crebrf	T	C	17: 26,742,883	V318A	possibly damaging	Het
Dab1	T	C	4: 104,605,325	I32T	probably damaging	Het
Daw1	T	C	1: 83,191,345	V181A	probably damaging	Het
Dlg2	G	A	7: 91,965,617	E255K	possibly damaging	Het
Dnah10	T	A	5: 124,829,587	D4170E	possibly damaging	Het
Dnah12	A	G	14: 26,814,459	T2111A	possibly damaging	Het
Dock10	T	C	1: 80,549,789	Y1081C	possibly damaging	Het
Dscam	T	C	16: 96,819,912	Y532C	probably damaging	Het
Fam83c	T	C	2: 155,830,303	D404G	probably benign	Het
Fam83g	A	G	11: 61,702,975	N445S	possibly damaging	Het
Ghr	C	T	15: 3,327,982	C268Y	probably damaging	Het
Gm8444	T	C	15: 81,843,574		probably benign	Het
Gp6	T	A	7: 4,384,989	K160N	probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Gtf3c2	C	A	5: 31,168,096	G450C	probably damaging	Het
Icosl	A	T	10: 78,071,953	M116L	possibly damaging	Het
Il31ra	T	G	13: 112,530,356	Y396S	probably damaging	Het
Insig1	A	G	5: 28,071,466	N10S	probably benign	Het
Kcnh2	C	A	5: 24,326,570	G448C	probably damaging	Het
L1td1	C	T	4: 98,733,489	S96L	possibly damaging	Het
Mapre3	A	T	5: 30,861,824	N4I	probably damaging	Het
Mblac2	T	A	13: 81,711,741	D70E	probably benign	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mkl2	G	T	16: 13,381,576	E98*	probably null	Het
Mpg	A	G	11: 32,231,840	I283V	probably benign	Het
Mybpc1	C	A	10: 88,546,059	A576S	probably damaging	Het
Myo1h	T	G	5: 114,361,079	V129G	probably damaging	Het
Nars	A	T	18: 64,505,028	V285E	probably damaging	Het
Nbas	T	A	12: 13,414,741		probably null	Het
Neb	T	C	2: 52,199,444	D5172G	probably null	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Nyap1	T	C	5: 137,735,691	H360R	possibly damaging	Het
Nyx	A	G	X: 13,486,735	E276G	probably damaging	Het
Olfr111	C	T	17: 37,530,706	S243F	probably damaging	Het
Olfr1129	T	A	2: 87,575,192	M36K	probably benign	Het
Olfr1223	A	T	2: 89,144,897	V42E	probably benign	Het
Olfr1231	A	G	2: 89,302,816	Y259H	possibly damaging	Het
Olfr1361	T	C	13: 21,658,472	T284A	possibly damaging	Het
Olfr168	A	G	16: 19,530,705	Y72H	probably benign	Het
Olfr20	G	T	11: 73,354,692	C313F	probably benign	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Olfr868	A	T	9: 20,100,869	M37L	probably benign	Het
Olfr937	T	A	9: 39,060,433	T78S	probably damaging	Het
Paf1	C	A	7: 28,395,768		probably null	Het
Pcsk5	T	C	19: 17,477,916	D1050G	probably benign	Het
Pgap1	A	G	1: 54,551,061	S73P	possibly damaging	Het
Phtf1	G	A	3: 104,004,483		probably null	Het
Pik3ca	T	C	3: 32,450,057	L632P	probably damaging	Het
Plau	G	T	14: 20,838,692		probably null	Het
Pld4	A	T	12: 112,768,489	Q460L	possibly damaging	Het
Prdm2	T	A	4: 143,131,877	Q1614H	possibly damaging	Het
Ptprq	C	T	10: 107,666,546	G837D	probably damaging	Het
Rad9b	A	G	5: 122,339,779	V178A	possibly damaging	Het
Rfc1	G	T	5: 65,311,054	Y105*	probably null	Het
Sardh	G	A	2: 27,228,339	R460C	probably damaging	Het
Scn5a	C	A	9: 119,536,480	R367L	probably damaging	Het
Sdcbp	A	T	4: 6,386,536	I137L	probably benign	Het
Shmt2	A	G	10: 127,519,160	V273A	probably benign	Het
Slc5a9	G	T	4: 111,880,226	P612H	probably benign	Het
Slitrk4	TTGT	TT	X: 64,270,688		probably null	Het
Slitrk4	TG	T	X: 64,270,689		probably null	Het
Spata1	A	T	3: 146,493,683	S9T	probably benign	Het
Syn3	T	C	10: 86,073,233	T328A	probably benign	Het
Tdrd6	A	G	17: 43,628,655	F501L	probably damaging	Het
Tekt5	T	C	16: 10,395,206	I72V	probably benign	Het
Ticrr	T	C	7: 79,694,073	S1229P	possibly damaging	Het
Tlr6	T	C	5: 64,953,405	S720G	probably damaging	Het
Tmem156	T	A	5: 65,079,951	D87V	probably damaging	Het
Togaram1	T	A	12: 65,019,140	D1639E	probably damaging	Het
Ucn2	A	G	9: 108,986,362	K64R	probably benign	Het
Vmn2r57	T	A	7: 41,448,577	Y22F	probably benign	Het
Vwa1	T	C	4: 155,770,850	T269A	probably benign	Het
Washc5	A	G	15: 59,341,155	L892P	possibly damaging	Het
Wdr20	T	C	12: 110,793,568	V296A	probably damaging	Het
Xxylt1	A	T	16: 31,050,768	H171Q	probably damaging	Het
Zfp275	A	G	X: 73,353,235	T118A	possibly damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCTTCCACTCAGGGCAATG -3'
(R):5'- CAAAGAGCATCTCCCCTCTGAG -3'

Sequencing Primer
(F):5'- CCGCAAAGAGCTGGCTATG -3'
(R):5'- CCTCTGAGCCATCAAAAATATAGAG -3'

Posted On

2014-08-25