Incidental Mutation 'R2040:Hfm1'
ID 225511
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 040047-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R2040 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107049684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 426 (V426I)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
AlphaFold D3Z4R1
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: V426I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: V426I

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: V426I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: V426I

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137795
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Meta Mutation Damage Score 0.1523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,693,607 (GRCm39) I75L probably benign Het
Abca2 T C 2: 25,333,817 (GRCm39) L1755P probably damaging Het
Adam6b A T 12: 113,454,364 (GRCm39) I394L probably benign Het
Ano2 T A 6: 126,016,471 (GRCm39) N1001K probably benign Het
Arap2 A T 5: 62,906,259 (GRCm39) N253K probably damaging Het
Ascc3 T C 10: 50,604,227 (GRCm39) C1316R probably benign Het
Atox1 T C 11: 55,341,343 (GRCm39) Y64C probably benign Het
Atp13a1 A G 8: 70,259,702 (GRCm39) T1098A possibly damaging Het
Casr T C 16: 36,330,728 (GRCm39) E202G possibly damaging Het
Cct2 T C 10: 116,889,018 (GRCm39) T494A probably benign Het
Cd209e T A 8: 3,899,158 (GRCm39) N185Y probably damaging Het
Celsr1 A G 15: 85,917,088 (GRCm39) L295P probably damaging Het
Cyp26a1 A G 19: 37,686,499 (GRCm39) T48A possibly damaging Het
Elovl3 A G 19: 46,121,567 (GRCm39) S37G probably benign Het
Fbh1 T G 2: 11,774,706 (GRCm39) D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Frem3 G T 8: 81,342,455 (GRCm39) V1583L possibly damaging Het
Gm21863 C A 12: 20,004,515 (GRCm39) Q4K possibly damaging Het
Gm266 T C 12: 111,452,132 (GRCm39) T25A possibly damaging Het
Gm8674 T C 13: 50,055,705 (GRCm39) noncoding transcript Het
Greb1 T C 12: 16,752,651 (GRCm39) H897R probably damaging Het
Hells A G 19: 38,943,474 (GRCm39) D565G probably damaging Het
Ints6 G A 14: 62,951,138 (GRCm39) T297I probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kmt2b A T 7: 30,268,845 (GRCm39) M2628K probably damaging Het
Ktn1 T G 14: 47,938,069 (GRCm39) probably benign Het
Lyst T A 13: 13,815,807 (GRCm39) D1230E probably benign Het
Mboat1 T C 13: 30,425,300 (GRCm39) probably null Het
Moxd2 T C 6: 40,861,887 (GRCm39) probably null Het
Mtmr4 T C 11: 87,495,916 (GRCm39) M527T probably damaging Het
Myt1 T A 2: 181,467,717 (GRCm39) N1050K probably damaging Het
Ncoa6 A T 2: 155,248,000 (GRCm39) V1768E probably damaging Het
Nelfcd G A 2: 174,261,875 (GRCm39) C48Y probably damaging Het
Opn3 G A 1: 175,491,145 (GRCm39) A296V possibly damaging Het
Or13a22 T C 7: 140,073,295 (GRCm39) I248T probably benign Het
Or2z8 T A 8: 72,811,607 (GRCm39) F28I possibly damaging Het
Pam T C 1: 97,792,167 (GRCm39) E418G possibly damaging Het
Prrc2c A T 1: 162,525,126 (GRCm39) N493K probably damaging Het
Ptpn18 A G 1: 34,509,300 (GRCm39) Q165R probably damaging Het
Ptpro C A 6: 137,363,162 (GRCm39) probably benign Het
Ralgapa1 A G 12: 55,833,107 (GRCm39) F132S probably damaging Het
Robo1 T C 16: 72,730,630 (GRCm39) C244R probably damaging Het
Robo3 A C 9: 37,338,760 (GRCm39) V316G probably damaging Het
Rsl1 T C 13: 67,330,145 (GRCm39) S198P probably damaging Het
Rsph9 T C 17: 46,445,910 (GRCm39) D220G probably damaging Het
Rxfp2 A C 5: 149,993,677 (GRCm39) I580L probably benign Het
Septin7 G A 9: 25,199,532 (GRCm39) A144T possibly damaging Het
Sfn T C 4: 133,328,603 (GRCm39) K160E probably benign Het
Ski A G 4: 155,306,029 (GRCm39) Y317H probably damaging Het
Skic3 A C 13: 76,328,222 (GRCm39) R1423S probably damaging Het
Slc22a22 A T 15: 57,110,936 (GRCm39) Y430* probably null Het
Src A G 2: 157,299,030 (GRCm39) K9R probably benign Het
Srm C T 4: 148,678,453 (GRCm39) P255L possibly damaging Het
Stpg4 T A 17: 87,730,075 (GRCm39) N90I probably damaging Het
Sytl2 T A 7: 90,031,069 (GRCm39) probably benign Het
Tbpl2 T C 2: 23,984,871 (GRCm39) K92R probably benign Het
Tlcd4 G T 3: 121,024,975 (GRCm39) probably benign Het
Tmem38a T A 8: 73,335,096 (GRCm39) N178K probably damaging Het
Tnfaip3 T C 10: 18,883,900 (GRCm39) D160G possibly damaging Het
Vegfb T A 19: 6,963,407 (GRCm39) H119L possibly damaging Het
Vmn2r111 T A 17: 22,767,395 (GRCm39) I701F probably damaging Het
Vmn2r95 C T 17: 18,661,561 (GRCm39) L436F probably damaging Het
Wdr47 T C 3: 108,530,688 (GRCm39) C394R probably benign Het
Ythdc2 T A 18: 44,988,241 (GRCm39) Y16* probably null Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp353-ps A G 8: 42,535,333 (GRCm39) noncoding transcript Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTTCTCTGAGACCAAATTGAC -3'
(R):5'- GGTAGTAAACACGTTCACTTTCAGAG -3'

Sequencing Primer
(F):5'- CTGAGACCAAATTGACTAAATATCCC -3'
(R):5'- CGTTCACTTTCAGAGATAAACACAG -3'
Posted On 2014-08-25