Incidental Mutation 'R0145:Zfp462'
ID22552
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R0145 (G1) of strain 722
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55010529 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 832 (G832R)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098070
AA Change: G832R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: G832R

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55008908 missense probably benign
R7741:Zfp462 UTSW 4 55008637 missense probably benign 0.00
R7750:Zfp462 UTSW 4 55016958 missense probably benign 0.06
R7812:Zfp462 UTSW 4 55008509 missense probably benign 0.00
R7863:Zfp462 UTSW 4 55007747 missense probably benign
R7898:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7946:Zfp462 UTSW 4 55007747 missense probably benign
R7981:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7995:Zfp462 UTSW 4 55011907 missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55073106 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATTACACTGCCACCAATGGGG -3'
(R):5'- TCAGGTCCGAATGGTCAAAGTTGAG -3'

Sequencing Primer
(F):5'- CCAATGGGGCGGAGATCG -3'
(R):5'- CACCATAATGCTGTTGGAGGTC -3'
Posted On2013-04-16