Incidental Mutation 'R2006:Prdm2'
ID225520
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission 040015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2006 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143131877 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 1614 (Q1614H)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105778
AA Change: Q1614H

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Q1614H

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197026
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,313,449 F333L probably benign Het
Abcc2 T A 19: 43,805,061 F384Y probably damaging Het
Acr C T 15: 89,574,201 P362S probably benign Het
Acss3 T C 10: 106,963,010 D484G possibly damaging Het
Actrt1 A G X: 46,329,716 T203A probably benign Het
Agtpbp1 A T 13: 59,500,321 C562S probably benign Het
Ahnak A G 19: 9,007,075 K1908E probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Apaf1 A T 10: 91,061,772 I283N probably damaging Het
Bbx G A 16: 50,224,395 T493M possibly damaging Het
Best2 C T 8: 85,013,189 probably null Het
C4bp C A 1: 130,648,032 E75* probably null Het
Calr3 A T 8: 72,434,851 V144D probably damaging Het
Capn1 C T 19: 5,991,583 G632D probably damaging Het
Catsper2 C A 2: 121,406,357 E270* probably null Het
Ccdc110 A T 8: 45,943,312 I747F probably damaging Het
Ccdc15 T A 9: 37,315,472 D389V possibly damaging Het
Ccdc94 C T 17: 55,964,543 Q155* probably null Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Crb2 A T 2: 37,783,434 D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 4,084,753 probably benign Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Dab1 T C 4: 104,605,325 I32T probably damaging Het
Daw1 T C 1: 83,191,345 V181A probably damaging Het
Dlg2 G A 7: 91,965,617 E255K possibly damaging Het
Dnah10 T A 5: 124,829,587 D4170E possibly damaging Het
Dnah12 A G 14: 26,814,459 T2111A possibly damaging Het
Dock10 T C 1: 80,549,789 Y1081C possibly damaging Het
Dscam T C 16: 96,819,912 Y532C probably damaging Het
Fam83c T C 2: 155,830,303 D404G probably benign Het
Fam83g A G 11: 61,702,975 N445S possibly damaging Het
Ghr C T 15: 3,327,982 C268Y probably damaging Het
Gm8444 T C 15: 81,843,574 probably benign Het
Gp6 T A 7: 4,384,989 K160N probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Gtf3c2 C A 5: 31,168,096 G450C probably damaging Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Il31ra T G 13: 112,530,356 Y396S probably damaging Het
Insig1 A G 5: 28,071,466 N10S probably benign Het
Kcnh2 C A 5: 24,326,570 G448C probably damaging Het
L1td1 C T 4: 98,733,489 S96L possibly damaging Het
Mapre3 A T 5: 30,861,824 N4I probably damaging Het
Mblac2 T A 13: 81,711,741 D70E probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mkl2 G T 16: 13,381,576 E98* probably null Het
Mpg A G 11: 32,231,840 I283V probably benign Het
Mybpc1 C A 10: 88,546,059 A576S probably damaging Het
Myo1h T G 5: 114,361,079 V129G probably damaging Het
Nars A T 18: 64,505,028 V285E probably damaging Het
Nbas T A 12: 13,414,741 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nyap1 T C 5: 137,735,691 H360R possibly damaging Het
Nyx A G X: 13,486,735 E276G probably damaging Het
Olfr111 C T 17: 37,530,706 S243F probably damaging Het
Olfr1129 T A 2: 87,575,192 M36K probably benign Het
Olfr1223 A T 2: 89,144,897 V42E probably benign Het
Olfr1231 A G 2: 89,302,816 Y259H possibly damaging Het
Olfr1361 T C 13: 21,658,472 T284A possibly damaging Het
Olfr168 A G 16: 19,530,705 Y72H probably benign Het
Olfr20 G T 11: 73,354,692 C313F probably benign Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr868 A T 9: 20,100,869 M37L probably benign Het
Olfr937 T A 9: 39,060,433 T78S probably damaging Het
Paf1 C A 7: 28,395,768 probably null Het
Pcsk5 T C 19: 17,477,916 D1050G probably benign Het
Pgap1 A G 1: 54,551,061 S73P possibly damaging Het
Phtf1 G A 3: 104,004,483 probably null Het
Pik3c2b G T 1: 133,066,544 R82L probably damaging Het
Pik3ca T C 3: 32,450,057 L632P probably damaging Het
Plau G T 14: 20,838,692 probably null Het
Pld4 A T 12: 112,768,489 Q460L possibly damaging Het
Ptprq C T 10: 107,666,546 G837D probably damaging Het
Rad9b A G 5: 122,339,779 V178A possibly damaging Het
Rfc1 G T 5: 65,311,054 Y105* probably null Het
Sardh G A 2: 27,228,339 R460C probably damaging Het
Scn5a C A 9: 119,536,480 R367L probably damaging Het
Sdcbp A T 4: 6,386,536 I137L probably benign Het
Shmt2 A G 10: 127,519,160 V273A probably benign Het
Slc5a9 G T 4: 111,880,226 P612H probably benign Het
Slitrk4 TTGT TT X: 64,270,688 probably null Het
Slitrk4 TG T X: 64,270,689 probably null Het
Spata1 A T 3: 146,493,683 S9T probably benign Het
Syn3 T C 10: 86,073,233 T328A probably benign Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Ticrr T C 7: 79,694,073 S1229P possibly damaging Het
Tlr6 T C 5: 64,953,405 S720G probably damaging Het
Tmem156 T A 5: 65,079,951 D87V probably damaging Het
Togaram1 T A 12: 65,019,140 D1639E probably damaging Het
Ucn2 A G 9: 108,986,362 K64R probably benign Het
Vmn2r57 T A 7: 41,448,577 Y22F probably benign Het
Vwa1 T C 4: 155,770,850 T269A probably benign Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wdr20 T C 12: 110,793,568 V296A probably damaging Het
Xxylt1 A T 16: 31,050,768 H171Q probably damaging Het
Zfp275 A G X: 73,353,235 T118A possibly damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTAAAAGGACAGACGTC -3'
(R):5'- AAGCAAGCTCTTCATCCTTGAGG -3'

Sequencing Primer
(F):5'- TCCTCCAGGCCAGCTACAG -3'
(R):5'- CCTTGAGGAATTCTAGTCCCGTAAG -3'
Posted On2014-08-25