Incidental Mutation 'R2040:Ptpro'
ID 225522
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission 040047-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2040 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 137363162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
AlphaFold E9Q612
Predicted Effect probably benign
Transcript: ENSMUST00000077115
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167679
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,693,607 (GRCm39) I75L probably benign Het
Abca2 T C 2: 25,333,817 (GRCm39) L1755P probably damaging Het
Adam6b A T 12: 113,454,364 (GRCm39) I394L probably benign Het
Ano2 T A 6: 126,016,471 (GRCm39) N1001K probably benign Het
Arap2 A T 5: 62,906,259 (GRCm39) N253K probably damaging Het
Ascc3 T C 10: 50,604,227 (GRCm39) C1316R probably benign Het
Atox1 T C 11: 55,341,343 (GRCm39) Y64C probably benign Het
Atp13a1 A G 8: 70,259,702 (GRCm39) T1098A possibly damaging Het
Casr T C 16: 36,330,728 (GRCm39) E202G possibly damaging Het
Cct2 T C 10: 116,889,018 (GRCm39) T494A probably benign Het
Cd209e T A 8: 3,899,158 (GRCm39) N185Y probably damaging Het
Celsr1 A G 15: 85,917,088 (GRCm39) L295P probably damaging Het
Cyp26a1 A G 19: 37,686,499 (GRCm39) T48A possibly damaging Het
Elovl3 A G 19: 46,121,567 (GRCm39) S37G probably benign Het
Fbh1 T G 2: 11,774,706 (GRCm39) D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Frem3 G T 8: 81,342,455 (GRCm39) V1583L possibly damaging Het
Gm21863 C A 12: 20,004,515 (GRCm39) Q4K possibly damaging Het
Gm266 T C 12: 111,452,132 (GRCm39) T25A possibly damaging Het
Gm8674 T C 13: 50,055,705 (GRCm39) noncoding transcript Het
Greb1 T C 12: 16,752,651 (GRCm39) H897R probably damaging Het
Hells A G 19: 38,943,474 (GRCm39) D565G probably damaging Het
Hfm1 C T 5: 107,049,684 (GRCm39) V426I probably damaging Het
Ints6 G A 14: 62,951,138 (GRCm39) T297I probably damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Kmt2b A T 7: 30,268,845 (GRCm39) M2628K probably damaging Het
Ktn1 T G 14: 47,938,069 (GRCm39) probably benign Het
Lyst T A 13: 13,815,807 (GRCm39) D1230E probably benign Het
Mboat1 T C 13: 30,425,300 (GRCm39) probably null Het
Moxd2 T C 6: 40,861,887 (GRCm39) probably null Het
Mtmr4 T C 11: 87,495,916 (GRCm39) M527T probably damaging Het
Myt1 T A 2: 181,467,717 (GRCm39) N1050K probably damaging Het
Ncoa6 A T 2: 155,248,000 (GRCm39) V1768E probably damaging Het
Nelfcd G A 2: 174,261,875 (GRCm39) C48Y probably damaging Het
Opn3 G A 1: 175,491,145 (GRCm39) A296V possibly damaging Het
Or13a22 T C 7: 140,073,295 (GRCm39) I248T probably benign Het
Or2z8 T A 8: 72,811,607 (GRCm39) F28I possibly damaging Het
Pam T C 1: 97,792,167 (GRCm39) E418G possibly damaging Het
Prrc2c A T 1: 162,525,126 (GRCm39) N493K probably damaging Het
Ptpn18 A G 1: 34,509,300 (GRCm39) Q165R probably damaging Het
Ralgapa1 A G 12: 55,833,107 (GRCm39) F132S probably damaging Het
Robo1 T C 16: 72,730,630 (GRCm39) C244R probably damaging Het
Robo3 A C 9: 37,338,760 (GRCm39) V316G probably damaging Het
Rsl1 T C 13: 67,330,145 (GRCm39) S198P probably damaging Het
Rsph9 T C 17: 46,445,910 (GRCm39) D220G probably damaging Het
Rxfp2 A C 5: 149,993,677 (GRCm39) I580L probably benign Het
Septin7 G A 9: 25,199,532 (GRCm39) A144T possibly damaging Het
Sfn T C 4: 133,328,603 (GRCm39) K160E probably benign Het
Ski A G 4: 155,306,029 (GRCm39) Y317H probably damaging Het
Skic3 A C 13: 76,328,222 (GRCm39) R1423S probably damaging Het
Slc22a22 A T 15: 57,110,936 (GRCm39) Y430* probably null Het
Src A G 2: 157,299,030 (GRCm39) K9R probably benign Het
Srm C T 4: 148,678,453 (GRCm39) P255L possibly damaging Het
Stpg4 T A 17: 87,730,075 (GRCm39) N90I probably damaging Het
Sytl2 T A 7: 90,031,069 (GRCm39) probably benign Het
Tbpl2 T C 2: 23,984,871 (GRCm39) K92R probably benign Het
Tlcd4 G T 3: 121,024,975 (GRCm39) probably benign Het
Tmem38a T A 8: 73,335,096 (GRCm39) N178K probably damaging Het
Tnfaip3 T C 10: 18,883,900 (GRCm39) D160G possibly damaging Het
Vegfb T A 19: 6,963,407 (GRCm39) H119L possibly damaging Het
Vmn2r111 T A 17: 22,767,395 (GRCm39) I701F probably damaging Het
Vmn2r95 C T 17: 18,661,561 (GRCm39) L436F probably damaging Het
Wdr47 T C 3: 108,530,688 (GRCm39) C394R probably benign Het
Ythdc2 T A 18: 44,988,241 (GRCm39) Y16* probably null Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp353-ps A G 8: 42,535,333 (GRCm39) noncoding transcript Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4827:Ptpro UTSW 6 137,419,708 (GRCm39) missense probably damaging 1.00
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7236:Ptpro UTSW 6 137,345,335 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R7873:Ptpro UTSW 6 137,407,737 (GRCm39) missense probably benign 0.44
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9309:Ptpro UTSW 6 137,431,656 (GRCm39) missense probably damaging 1.00
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9625:Ptpro UTSW 6 137,371,873 (GRCm39) missense probably damaging 1.00
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTGGGCTACAGTTGGC -3'
(R):5'- CTGGCTTCTTACCTGGGTAC -3'

Sequencing Primer
(F):5'- CTACAGTTGGCAGAGGGTAGAC -3'
(R):5'- GGGTACAATACTGCTTCTCCAG -3'
Posted On 2014-08-25