Mutagenetix > Incidental Mutation

Incidental Mutation 'R2040:Cd209e'

225529

Institutional Source

Beutler Lab

Gene Symbol

Cd209e

Ensembl Gene

ENSMUSG00000040197

Gene Name

CD209e antigen

Synonyms

mSIGNR4, SIGNR4

MMRRC Submission

040047-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.049) question?

Stock #

R2040 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

3847965-3854309 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3849158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 185 (N185Y)

Ref Sequence

ENSEMBL: ENSMUSP00000033888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033888]

AlphaFold

Q91ZW7

Predicted Effect

probably damaging
Transcript: ENSMUST00000033888
AA Change: N185Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: N185Y

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

Meta Mutation Damage Score

0.7186

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,741	I75L	probably benign	Het
Abca2	T	C	2: 25,443,805	L1755P	probably damaging	Het
Adam6b	A	T	12: 113,490,744	I394L	probably benign	Het
Ano2	T	A	6: 126,039,508	N1001K	probably benign	Het
Arap2	A	T	5: 62,748,916	N253K	probably damaging	Het
Ascc3	T	C	10: 50,728,131	C1316R	probably benign	Het
Atox1	T	C	11: 55,450,517	Y64C	probably benign	Het
Atp13a1	A	G	8: 69,807,052	T1098A	possibly damaging	Het
Casr	T	C	16: 36,510,366	E202G	possibly damaging	Het
Cct2	T	C	10: 117,053,113	T494A	probably benign	Het
Celsr1	A	G	15: 86,032,887	L295P	probably damaging	Het
Cyp26a1	A	G	19: 37,698,051	T48A	possibly damaging	Het
Elovl3	A	G	19: 46,133,128	S37G	probably benign	Het
Fbxo18	T	G	2: 11,769,895	D13A	possibly damaging	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Frem3	G	T	8: 80,615,826	V1583L	possibly damaging	Het
Gm21863	C	A	12: 19,954,514	Q4K	possibly damaging	Het
Gm266	T	C	12: 111,485,698	T25A	possibly damaging	Het
Gm8674	T	C	13: 49,901,669		noncoding transcript	Het
Greb1	T	C	12: 16,702,650	H897R	probably damaging	Het
Hells	A	G	19: 38,955,030	D565G	probably damaging	Het
Hfm1	C	T	5: 106,901,818	V426I	probably damaging	Het
Ints6	G	A	14: 62,713,689	T297I	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kmt2b	A	T	7: 30,569,420	M2628K	probably damaging	Het
Ktn1	T	G	14: 47,700,612		probably benign	Het
Lyst	T	A	13: 13,641,222	D1230E	probably benign	Het
Mboat1	T	C	13: 30,241,317		probably null	Het
Moxd2	T	C	6: 40,884,953		probably null	Het
Mtmr4	T	C	11: 87,605,090	M527T	probably damaging	Het
Myt1	T	A	2: 181,825,924	N1050K	probably damaging	Het
Ncoa6	A	T	2: 155,406,080	V1768E	probably damaging	Het
Nelfcd	G	A	2: 174,420,082	C48Y	probably damaging	Het
Olfr372	T	A	8: 72,057,763	F28I	possibly damaging	Het
Olfr535	T	C	7: 140,493,382	I248T	probably benign	Het
Opn3	G	A	1: 175,663,579	A296V	possibly damaging	Het
Pam	T	C	1: 97,864,442	E418G	possibly damaging	Het
Prrc2c	A	T	1: 162,697,557	N493K	probably damaging	Het
Ptpn18	A	G	1: 34,470,219	Q165R	probably damaging	Het
Ptpro	C	A	6: 137,386,164		probably benign	Het
Ralgapa1	A	G	12: 55,786,322	F132S	probably damaging	Het
Robo1	T	C	16: 72,933,742	C244R	probably damaging	Het
Robo3	A	C	9: 37,427,464	V316G	probably damaging	Het
Rsl1	T	C	13: 67,182,081	S198P	probably damaging	Het
Rsph9	T	C	17: 46,134,984	D220G	probably damaging	Het
Rxfp2	A	C	5: 150,070,212	I580L	probably benign	Het
Sept7	G	A	9: 25,288,236	A144T	possibly damaging	Het
Sfn	T	C	4: 133,601,292	K160E	probably benign	Het
Ski	A	G	4: 155,221,572	Y317H	probably damaging	Het
Slc22a22	A	T	15: 57,247,540	Y430*	probably null	Het
Src	A	G	2: 157,457,110	K9R	probably benign	Het
Srm	C	T	4: 148,593,996	P255L	possibly damaging	Het
Stpg4	T	A	17: 87,422,647	N90I	probably damaging	Het
Sytl2	T	A	7: 90,381,861		probably benign	Het
Tbpl2	T	C	2: 24,094,859	K92R	probably benign	Het
Tmem38a	T	A	8: 72,581,252	N178K	probably damaging	Het
Tmem56	G	T	3: 121,231,326		probably benign	Het
Tnfaip3	T	C	10: 19,008,152	D160G	possibly damaging	Het
Ttc37	A	C	13: 76,180,103	R1423S	probably damaging	Het
Vegfb	T	A	19: 6,986,039	H119L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,414	I701F	probably damaging	Het
Vmn2r95	C	T	17: 18,441,299	L436F	probably damaging	Het
Wdr47	T	C	3: 108,623,372	C394R	probably benign	Het
Ythdc2	T	A	18: 44,855,174	Y16*	probably null	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp353-ps	A	G	8: 42,082,296		noncoding transcript	Het

Other mutations in Cd209e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cd209e	APN	8	3852800	missense	probably benign	0.05
IGL00920:Cd209e	APN	8	3849187	missense	probably damaging	1.00
IGL01132:Cd209e	APN	8	3851274	missense	probably benign	0.18
IGL02499:Cd209e	APN	8	3854238	missense	probably benign
R0124:Cd209e	UTSW	8	3851274	missense	probably benign	0.08
R0268:Cd209e	UTSW	8	3849125	missense	probably benign	0.34
R0540:Cd209e	UTSW	8	3851265	missense	probably benign	0.04
R0744:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R0836:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R1241:Cd209e	UTSW	8	3849124	missense	probably damaging	0.99
R1367:Cd209e	UTSW	8	3849084	makesense	probably null
R2136:Cd209e	UTSW	8	3853248	missense	probably benign	0.00
R4787:Cd209e	UTSW	8	3851181	missense	probably null	0.69
R6283:Cd209e	UTSW	8	3849212	nonsense	probably null
R6338:Cd209e	UTSW	8	3849154	missense	probably damaging	1.00
R6894:Cd209e	UTSW	8	3853569	missense	possibly damaging	0.48
R8899:Cd209e	UTSW	8	3851212	nonsense	probably null
R9594:Cd209e	UTSW	8	3851183	missense	probably benign	0.00
Z1176:Cd209e	UTSW	8	3849196	missense	probably benign	0.30
Z1177:Cd209e	UTSW	8	3851181	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCCATAGACAGGGAGTAGGA -3'
(R):5'- AAGACTTCATACGATGCAGGT -3'

Sequencing Primer
(F):5'- AACTGGGAAACGCATGAGTG -3'
(R):5'- AAGGTCTGTCCATCACGATG -3'

Posted On

2014-08-25