Incidental Mutation 'R2006:Tlr6'
ID225535
Institutional Source Beutler Lab
Gene Symbol Tlr6
Ensembl Gene ENSMUSG00000051498
Gene Nametoll-like receptor 6
Synonyms
MMRRC Submission 040015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2006 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location64952031-64960097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64953405 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 720 (S720G)
Ref Sequence ENSEMBL: ENSMUSP00000062096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062315] [ENSMUST00000201307]
Predicted Effect probably damaging
Transcript: ENSMUST00000062315
AA Change: S720G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062096
Gene: ENSMUSG00000051498
AA Change: S720G

DomainStartEndE-ValueType
LRR_TYP 86 109 7.67e-2 SMART
LRR 131 155 2.76e1 SMART
LRR 461 482 6.23e1 SMART
LRR 483 507 4.57e0 SMART
LRRCT 540 594 4.06e-11 SMART
transmembrane domain 596 618 N/A INTRINSIC
TIR 652 795 5.37e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201307
SMART Domains Protein: ENSMUSP00000143865
Gene: ENSMUSG00000051498

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
LRR_TYP 86 109 3.3e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
PHENOTYPE: Inactivation of this gene results in abnormal macrophage function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,313,449 F333L probably benign Het
Abcc2 T A 19: 43,805,061 F384Y probably damaging Het
Acr C T 15: 89,574,201 P362S probably benign Het
Acss3 T C 10: 106,963,010 D484G possibly damaging Het
Actrt1 A G X: 46,329,716 T203A probably benign Het
Agtpbp1 A T 13: 59,500,321 C562S probably benign Het
Ahnak A G 19: 9,007,075 K1908E probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Apaf1 A T 10: 91,061,772 I283N probably damaging Het
Bbx G A 16: 50,224,395 T493M possibly damaging Het
Best2 C T 8: 85,013,189 probably null Het
C4bp C A 1: 130,648,032 E75* probably null Het
Calr3 A T 8: 72,434,851 V144D probably damaging Het
Capn1 C T 19: 5,991,583 G632D probably damaging Het
Catsper2 C A 2: 121,406,357 E270* probably null Het
Ccdc110 A T 8: 45,943,312 I747F probably damaging Het
Ccdc15 T A 9: 37,315,472 D389V possibly damaging Het
Ccdc94 C T 17: 55,964,543 Q155* probably null Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Crb2 A T 2: 37,783,434 D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 4,084,753 probably benign Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Dab1 T C 4: 104,605,325 I32T probably damaging Het
Daw1 T C 1: 83,191,345 V181A probably damaging Het
Dlg2 G A 7: 91,965,617 E255K possibly damaging Het
Dnah10 T A 5: 124,829,587 D4170E possibly damaging Het
Dnah12 A G 14: 26,814,459 T2111A possibly damaging Het
Dock10 T C 1: 80,549,789 Y1081C possibly damaging Het
Dscam T C 16: 96,819,912 Y532C probably damaging Het
Fam83c T C 2: 155,830,303 D404G probably benign Het
Fam83g A G 11: 61,702,975 N445S possibly damaging Het
Ghr C T 15: 3,327,982 C268Y probably damaging Het
Gm8444 T C 15: 81,843,574 probably benign Het
Gp6 T A 7: 4,384,989 K160N probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Gtf3c2 C A 5: 31,168,096 G450C probably damaging Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Il31ra T G 13: 112,530,356 Y396S probably damaging Het
Insig1 A G 5: 28,071,466 N10S probably benign Het
Kcnh2 C A 5: 24,326,570 G448C probably damaging Het
L1td1 C T 4: 98,733,489 S96L possibly damaging Het
Mapre3 A T 5: 30,861,824 N4I probably damaging Het
Mblac2 T A 13: 81,711,741 D70E probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mkl2 G T 16: 13,381,576 E98* probably null Het
Mpg A G 11: 32,231,840 I283V probably benign Het
Mybpc1 C A 10: 88,546,059 A576S probably damaging Het
Myo1h T G 5: 114,361,079 V129G probably damaging Het
Nars A T 18: 64,505,028 V285E probably damaging Het
Nbas T A 12: 13,414,741 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nyap1 T C 5: 137,735,691 H360R possibly damaging Het
Nyx A G X: 13,486,735 E276G probably damaging Het
Olfr111 C T 17: 37,530,706 S243F probably damaging Het
Olfr1129 T A 2: 87,575,192 M36K probably benign Het
Olfr1223 A T 2: 89,144,897 V42E probably benign Het
Olfr1231 A G 2: 89,302,816 Y259H possibly damaging Het
Olfr1361 T C 13: 21,658,472 T284A possibly damaging Het
Olfr168 A G 16: 19,530,705 Y72H probably benign Het
Olfr20 G T 11: 73,354,692 C313F probably benign Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr868 A T 9: 20,100,869 M37L probably benign Het
Olfr937 T A 9: 39,060,433 T78S probably damaging Het
Paf1 C A 7: 28,395,768 probably null Het
Pcsk5 T C 19: 17,477,916 D1050G probably benign Het
Pgap1 A G 1: 54,551,061 S73P possibly damaging Het
Phtf1 G A 3: 104,004,483 probably null Het
Pik3c2b G T 1: 133,066,544 R82L probably damaging Het
Pik3ca T C 3: 32,450,057 L632P probably damaging Het
Plau G T 14: 20,838,692 probably null Het
Pld4 A T 12: 112,768,489 Q460L possibly damaging Het
Prdm2 T A 4: 143,131,877 Q1614H possibly damaging Het
Ptprq C T 10: 107,666,546 G837D probably damaging Het
Rad9b A G 5: 122,339,779 V178A possibly damaging Het
Rfc1 G T 5: 65,311,054 Y105* probably null Het
Sardh G A 2: 27,228,339 R460C probably damaging Het
Scn5a C A 9: 119,536,480 R367L probably damaging Het
Sdcbp A T 4: 6,386,536 I137L probably benign Het
Shmt2 A G 10: 127,519,160 V273A probably benign Het
Slc5a9 G T 4: 111,880,226 P612H probably benign Het
Slitrk4 TTGT TT X: 64,270,688 probably null Het
Slitrk4 TG T X: 64,270,689 probably null Het
Spata1 A T 3: 146,493,683 S9T probably benign Het
Syn3 T C 10: 86,073,233 T328A probably benign Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Ticrr T C 7: 79,694,073 S1229P possibly damaging Het
Tmem156 T A 5: 65,079,951 D87V probably damaging Het
Togaram1 T A 12: 65,019,140 D1639E probably damaging Het
Ucn2 A G 9: 108,986,362 K64R probably benign Het
Vmn2r57 T A 7: 41,448,577 Y22F probably benign Het
Vwa1 T C 4: 155,770,850 T269A probably benign Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wdr20 T C 12: 110,793,568 V296A probably damaging Het
Xxylt1 A T 16: 31,050,768 H171Q probably damaging Het
Zfp275 A G X: 73,353,235 T118A possibly damaging Het
Other mutations in Tlr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Tlr6 APN 5 64953512 missense probably damaging 1.00
IGL00963:Tlr6 APN 5 64954676 missense possibly damaging 0.89
IGL01540:Tlr6 APN 5 64955286 missense probably damaging 0.97
IGL01675:Tlr6 APN 5 64954499 missense probably damaging 1.00
IGL01705:Tlr6 APN 5 64954130 missense probably benign 0.03
IGL02256:Tlr6 APN 5 64954944 missense probably benign 0.00
Counterintuitive UTSW 5 64953595 missense probably damaging 1.00
insouciant UTSW 5 64954583 missense possibly damaging 0.81
m2sd1 UTSW 5 64954194 nonsense
m2sd2 UTSW 5 64954394 nonsense
m2sd3 UTSW 5 64954241 missense probably damaging 0.98
One_off UTSW 5 64953251 missense probably damaging 1.00
R0336:Tlr6 UTSW 5 64953946 missense probably benign 0.02
R0388:Tlr6 UTSW 5 64955205 missense possibly damaging 0.74
R0558:Tlr6 UTSW 5 64954860 nonsense probably null
R0671:Tlr6 UTSW 5 64954592 missense probably benign 0.00
R1171:Tlr6 UTSW 5 64955250 missense probably benign 0.00
R1550:Tlr6 UTSW 5 64953411 missense probably damaging 0.98
R1809:Tlr6 UTSW 5 64953712 nonsense probably null
R1868:Tlr6 UTSW 5 64954829 missense probably benign 0.00
R1876:Tlr6 UTSW 5 64955420 missense probably damaging 1.00
R1893:Tlr6 UTSW 5 64953213 missense probably damaging 1.00
R2055:Tlr6 UTSW 5 64953926 missense probably damaging 1.00
R3087:Tlr6 UTSW 5 64954325 missense probably damaging 1.00
R3406:Tlr6 UTSW 5 64953429 missense probably damaging 1.00
R3711:Tlr6 UTSW 5 64953809 missense possibly damaging 0.75
R3938:Tlr6 UTSW 5 64953595 missense probably damaging 1.00
R3962:Tlr6 UTSW 5 64954985 missense probably benign 0.10
R4152:Tlr6 UTSW 5 64953212 missense probably damaging 1.00
R4274:Tlr6 UTSW 5 64953638 missense probably benign 0.01
R4516:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4518:Tlr6 UTSW 5 64954904 missense possibly damaging 0.67
R4762:Tlr6 UTSW 5 64954396 missense probably benign 0.09
R4959:Tlr6 UTSW 5 64953659 missense possibly damaging 0.81
R5119:Tlr6 UTSW 5 64954301 missense probably benign 0.06
R5248:Tlr6 UTSW 5 64955304 missense probably benign 0.30
R5507:Tlr6 UTSW 5 64953406 missense probably damaging 1.00
R5572:Tlr6 UTSW 5 64955018 missense probably damaging 1.00
R5773:Tlr6 UTSW 5 64954503 missense probably benign 0.00
R6711:Tlr6 UTSW 5 64954492 missense probably damaging 1.00
R7096:Tlr6 UTSW 5 64953776 missense probably benign
R7341:Tlr6 UTSW 5 64953629 missense probably benign 0.32
R7594:Tlr6 UTSW 5 64953251 missense probably damaging 1.00
R7754:Tlr6 UTSW 5 64954350 missense possibly damaging 0.64
R7774:Tlr6 UTSW 5 64953385 missense probably damaging 0.99
Z1177:Tlr6 UTSW 5 64955239 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATGAAGCTCTAAGGTTGGCC -3'
(R):5'- ACAGTGAGCATGATTCTGCCTG -3'

Sequencing Primer
(F):5'- GCTCTAAGGTTGGCCCAAAACAG -3'
(R):5'- CATGATTCTGCCTGGGTGAAGAAC -3'
Posted On2014-08-25