Mutagenetix > Incidental Mutations

Incidental Mutation 'R2040:Sept7'

225541

Institutional Source

Beutler Lab

Gene Symbol

Sept7

Ensembl Gene

ENSMUSG00000001833

Gene Name

septin 7

Synonyms

Cdc10

MMRRC Submission

040047-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2040 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25252439-25308571 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25288236 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 144 (A144T)

Ref Sequence

ENSEMBL: ENSMUSP00000127641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115272
AA Change: A144T

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: A144T

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:Septin	47	323	1.7e-126	PFAM
Pfam:MMR_HSR1	52	252	2.5e-8	PFAM
low complexity region	349	371	N/A	INTRINSIC
low complexity region	395	408	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165594
AA Change: A144T

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: A144T

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:Septin	47	323	1.6e-126	PFAM
Pfam:MMR_HSR1	52	197	4.9e-8	PFAM
low complexity region	349	371	N/A	INTRINSIC
low complexity region	395	408	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213980

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217598

Meta Mutation Damage Score

0.0971

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	T	5: 107,545,741	I75L	probably benign	Het
Abca2	T	C	2: 25,443,805	L1755P	probably damaging	Het
Adam6b	A	T	12: 113,490,744	I394L	probably benign	Het
Ano2	T	A	6: 126,039,508	N1001K	probably benign	Het
Arap2	A	T	5: 62,748,916	N253K	probably damaging	Het
Ascc3	T	C	10: 50,728,131	C1316R	probably benign	Het
Atox1	T	C	11: 55,450,517	Y64C	probably benign	Het
Atp13a1	A	G	8: 69,807,052	T1098A	possibly damaging	Het
Casr	T	C	16: 36,510,366	E202G	possibly damaging	Het
Cct2	T	C	10: 117,053,113	T494A	probably benign	Het
Cd209e	T	A	8: 3,849,158	N185Y	probably damaging	Het
Celsr1	A	G	15: 86,032,887	L295P	probably damaging	Het
Cyp26a1	A	G	19: 37,698,051	T48A	possibly damaging	Het
Elovl3	A	G	19: 46,133,128	S37G	probably benign	Het
Fbxo18	T	G	2: 11,769,895	D13A	possibly damaging	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Frem3	G	T	8: 80,615,826	V1583L	possibly damaging	Het
Gm21863	C	A	12: 19,954,514	Q4K	possibly damaging	Het
Gm266	T	C	12: 111,485,698	T25A	possibly damaging	Het
Gm8674	T	C	13: 49,901,669		noncoding transcript	Het
Greb1	T	C	12: 16,702,650	H897R	probably damaging	Het
Hells	A	G	19: 38,955,030	D565G	probably damaging	Het
Hfm1	C	T	5: 106,901,818	V426I	probably damaging	Het
Ints6	G	A	14: 62,713,689	T297I	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Kmt2b	A	T	7: 30,569,420	M2628K	probably damaging	Het
Ktn1	T	G	14: 47,700,612		probably benign	Het
Lyst	T	A	13: 13,641,222	D1230E	probably benign	Het
Mboat1	T	C	13: 30,241,317		probably null	Het
Moxd2	T	C	6: 40,884,953		probably null	Het
Mtmr4	T	C	11: 87,605,090	M527T	probably damaging	Het
Myt1	T	A	2: 181,825,924	N1050K	probably damaging	Het
Ncoa6	A	T	2: 155,406,080	V1768E	probably damaging	Het
Nelfcd	G	A	2: 174,420,082	C48Y	probably damaging	Het
Olfr372	T	A	8: 72,057,763	F28I	possibly damaging	Het
Olfr535	T	C	7: 140,493,382	I248T	probably benign	Het
Opn3	G	A	1: 175,663,579	A296V	possibly damaging	Het
Pam	T	C	1: 97,864,442	E418G	possibly damaging	Het
Prrc2c	A	T	1: 162,697,557	N493K	probably damaging	Het
Ptpn18	A	G	1: 34,470,219	Q165R	probably damaging	Het
Ptpro	C	A	6: 137,386,164		probably benign	Het
Ralgapa1	A	G	12: 55,786,322	F132S	probably damaging	Het
Robo1	T	C	16: 72,933,742	C244R	probably damaging	Het
Robo3	A	C	9: 37,427,464	V316G	probably damaging	Het
Rsl1	T	C	13: 67,182,081	S198P	probably damaging	Het
Rsph9	T	C	17: 46,134,984	D220G	probably damaging	Het
Rxfp2	A	C	5: 150,070,212	I580L	probably benign	Het
Sfn	T	C	4: 133,601,292	K160E	probably benign	Het
Ski	A	G	4: 155,221,572	Y317H	probably damaging	Het
Slc22a22	A	T	15: 57,247,540	Y430*	probably null	Het
Src	A	G	2: 157,457,110	K9R	probably benign	Het
Srm	C	T	4: 148,593,996	P255L	possibly damaging	Het
Stpg4	T	A	17: 87,422,647	N90I	probably damaging	Het
Sytl2	T	A	7: 90,381,861		probably benign	Het
Tbpl2	T	C	2: 24,094,859	K92R	probably benign	Het
Tmem38a	T	A	8: 72,581,252	N178K	probably damaging	Het
Tmem56	G	T	3: 121,231,326		probably benign	Het
Tnfaip3	T	C	10: 19,008,152	D160G	possibly damaging	Het
Ttc37	A	C	13: 76,180,103	R1423S	probably damaging	Het
Vegfb	T	A	19: 6,986,039	H119L	possibly damaging	Het
Vmn2r111	T	A	17: 22,548,414	I701F	probably damaging	Het
Vmn2r95	C	T	17: 18,441,299	L436F	probably damaging	Het
Wdr47	T	C	3: 108,623,372	C394R	probably benign	Het
Ythdc2	T	A	18: 44,855,174	Y16*	probably null	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp353-ps	A	G	8: 42,082,296		noncoding transcript	Het

Other mutations in Sept7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02692:Sept7	APN	9	25296490	splice site	probably benign
R0331:Sept7	UTSW	9	25306256	missense	probably benign	0.00
R1590:Sept7	UTSW	9	25277604	missense	probably damaging	0.99
R4935:Sept7	UTSW	9	25306172	missense	probably benign	0.03
R5246:Sept7	UTSW	9	25299536	missense	probably damaging	1.00
R5426:Sept7	UTSW	9	25286690	missense	possibly damaging	0.92
R5629:Sept7	UTSW	9	25288293	missense	probably damaging	1.00
R5994:Sept7	UTSW	9	25288198	missense	possibly damaging	0.52
R6177:Sept7	UTSW	9	25293804	critical splice donor site	probably null
R6246:Sept7	UTSW	9	25307521	missense	probably benign	0.00
R6735:Sept7	UTSW	9	25303752	missense	possibly damaging	0.94
R7561:Sept7	UTSW	9	25297855	missense	possibly damaging	0.77
R7837:Sept7	UTSW	9	25288235	missense	possibly damaging	0.92
R8442:Sept7	UTSW	9	25252642	missense	unknown
R8852:Sept7	UTSW	9	25252684	missense	possibly damaging	0.68
R8860:Sept7	UTSW	9	25252684	missense	possibly damaging	0.68
X0066:Sept7	UTSW	9	25306140	missense	possibly damaging	0.88
Z1176:Sept7	UTSW	9	25252556	start gained	probably benign
Z1177:Sept7	UTSW	9	25301423	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TACCTACTTTTGAGTCAGTGTGCAG -3'
(R):5'- TAAATGACCTAGTTCCGTGTACTCC -3'

Sequencing Primer
(F):5'- TGAGTCAGTGTGCAGAAAAATTTG -3'
(R):5'- AGTTCCGTGTACTCCACAGAC -3'

Posted On

2014-08-25