Incidental Mutation 'R2040:Sept7'
ID225541
Institutional Source Beutler Lab
Gene Symbol Sept7
Ensembl Gene ENSMUSG00000001833
Gene Nameseptin 7
SynonymsCdc10
MMRRC Submission 040047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2040 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location25252439-25308571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25288236 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 144 (A144T)
Ref Sequence ENSEMBL: ENSMUSP00000127641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115272] [ENSMUST00000165594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115272
AA Change: A144T

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110927
Gene: ENSMUSG00000001833
AA Change: A144T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.7e-126 PFAM
Pfam:MMR_HSR1 52 252 2.5e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165594
AA Change: A144T

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127641
Gene: ENSMUSG00000001833
AA Change: A144T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Septin 47 323 1.6e-126 PFAM
Pfam:MMR_HSR1 52 197 4.9e-8 PFAM
low complexity region 349 371 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217598
Meta Mutation Damage Score 0.0971 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons exhibit reduced axon and dendrite length and complexity. Mice homozygous for a knock-out allele die prior to E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Pam T C 1: 97,864,442 E418G possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpn18 A G 1: 34,470,219 Q165R probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vegfb T A 19: 6,986,039 H119L possibly damaging Het
Vmn2r111 T A 17: 22,548,414 I701F probably damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Ythdc2 T A 18: 44,855,174 Y16* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Sept7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Sept7 APN 9 25296490 splice site probably benign
R0331:Sept7 UTSW 9 25306256 missense probably benign 0.00
R1590:Sept7 UTSW 9 25277604 missense probably damaging 0.99
R4935:Sept7 UTSW 9 25306172 missense probably benign 0.03
R5246:Sept7 UTSW 9 25299536 missense probably damaging 1.00
R5426:Sept7 UTSW 9 25286690 missense possibly damaging 0.92
R5629:Sept7 UTSW 9 25288293 missense probably damaging 1.00
R5994:Sept7 UTSW 9 25288198 missense possibly damaging 0.52
R6177:Sept7 UTSW 9 25293804 critical splice donor site probably null
R6246:Sept7 UTSW 9 25307521 missense probably benign 0.00
R6735:Sept7 UTSW 9 25303752 missense possibly damaging 0.94
R7561:Sept7 UTSW 9 25297855 missense possibly damaging 0.77
R7837:Sept7 UTSW 9 25288235 missense possibly damaging 0.92
R8442:Sept7 UTSW 9 25252642 missense unknown
R8852:Sept7 UTSW 9 25252684 missense possibly damaging 0.68
R8860:Sept7 UTSW 9 25252684 missense possibly damaging 0.68
X0066:Sept7 UTSW 9 25306140 missense possibly damaging 0.88
Z1176:Sept7 UTSW 9 25252556 start gained probably benign
Z1177:Sept7 UTSW 9 25301423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TACCTACTTTTGAGTCAGTGTGCAG -3'
(R):5'- TAAATGACCTAGTTCCGTGTACTCC -3'

Sequencing Primer
(F):5'- TGAGTCAGTGTGCAGAAAAATTTG -3'
(R):5'- AGTTCCGTGTACTCCACAGAC -3'
Posted On2014-08-25