Incidental Mutation 'R2006:Ticrr'
ID 225558
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 040015-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R2006 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79343821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1229 (S1229P)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: S1229P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S1229P

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,204,275 (GRCm39) F333L probably benign Het
Abcc2 T A 19: 43,793,500 (GRCm39) F384Y probably damaging Het
Acr C T 15: 89,458,404 (GRCm39) P362S probably benign Het
Acss3 T C 10: 106,798,871 (GRCm39) D484G possibly damaging Het
Actrt1 A G X: 45,418,593 (GRCm39) T203A probably benign Het
Agtpbp1 A T 13: 59,648,135 (GRCm39) C562S probably benign Het
Ahnak A G 19: 8,984,439 (GRCm39) K1908E probably damaging Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Apaf1 A T 10: 90,897,634 (GRCm39) I283N probably damaging Het
Bbx G A 16: 50,044,758 (GRCm39) T493M possibly damaging Het
Best2 C T 8: 85,739,818 (GRCm39) probably null Het
C4bp C A 1: 130,575,769 (GRCm39) E75* probably null Het
Calr3 A T 8: 73,188,695 (GRCm39) V144D probably damaging Het
Capn1 C T 19: 6,041,613 (GRCm39) G632D probably damaging Het
Catsper2 C A 2: 121,236,838 (GRCm39) E270* probably null Het
Ccdc110 A T 8: 46,396,349 (GRCm39) I747F probably damaging Het
Ccdc15 T A 9: 37,226,768 (GRCm39) D389V possibly damaging Het
Cd226 A G 18: 89,265,435 (GRCm39) I125V probably benign Het
Crb2 A T 2: 37,673,446 (GRCm39) D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 3,902,617 (GRCm39) probably benign Het
Crebrf T C 17: 26,961,857 (GRCm39) V318A possibly damaging Het
Dab1 T C 4: 104,462,522 (GRCm39) I32T probably damaging Het
Daw1 T C 1: 83,169,066 (GRCm39) V181A probably damaging Het
Dlg2 G A 7: 91,614,825 (GRCm39) E255K possibly damaging Het
Dnah10 T A 5: 124,906,651 (GRCm39) D4170E possibly damaging Het
Dnah12 A G 14: 26,536,416 (GRCm39) T2111A possibly damaging Het
Dock10 T C 1: 80,527,506 (GRCm39) Y1081C possibly damaging Het
Dscam T C 16: 96,621,112 (GRCm39) Y532C probably damaging Het
Fam83c T C 2: 155,672,223 (GRCm39) D404G probably benign Het
Fam83g A G 11: 61,593,801 (GRCm39) N445S possibly damaging Het
Ghr C T 15: 3,357,464 (GRCm39) C268Y probably damaging Het
Gm8444 T C 15: 81,727,775 (GRCm39) probably benign Het
Gp6 T A 7: 4,387,988 (GRCm39) K160N probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Gtf3c2 C A 5: 31,325,440 (GRCm39) G450C probably damaging Het
Icosl A T 10: 77,907,787 (GRCm39) M116L possibly damaging Het
Il31ra T G 13: 112,666,890 (GRCm39) Y396S probably damaging Het
Insig1 A G 5: 28,276,464 (GRCm39) N10S probably benign Het
Kcnh2 C A 5: 24,531,568 (GRCm39) G448C probably damaging Het
L1td1 C T 4: 98,621,726 (GRCm39) S96L possibly damaging Het
Mapre3 A T 5: 31,019,168 (GRCm39) N4I probably damaging Het
Mblac2 T A 13: 81,859,860 (GRCm39) D70E probably benign Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mpg A G 11: 32,181,840 (GRCm39) I283V probably benign Het
Mrtfb G T 16: 13,199,440 (GRCm39) E98* probably null Het
Mybpc1 C A 10: 88,381,921 (GRCm39) A576S probably damaging Het
Myo1h T G 5: 114,499,140 (GRCm39) V129G probably damaging Het
Nars1 A T 18: 64,638,099 (GRCm39) V285E probably damaging Het
Nbas T A 12: 13,464,742 (GRCm39) probably null Het
Neb T C 2: 52,089,456 (GRCm39) D5172G probably null Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Nyap1 T C 5: 137,733,953 (GRCm39) H360R possibly damaging Het
Nyx A G X: 13,352,974 (GRCm39) E276G probably damaging Het
Or10ag59 T A 2: 87,405,536 (GRCm39) M36K probably benign Het
Or1e1 G T 11: 73,245,518 (GRCm39) C313F probably benign Het
Or2l13b A G 16: 19,349,455 (GRCm39) Y72H probably benign Het
Or2w6 T C 13: 21,842,642 (GRCm39) T284A possibly damaging Het
Or4c1 A G 2: 89,133,160 (GRCm39) Y259H possibly damaging Het
Or4c118 A T 2: 88,975,241 (GRCm39) V42E probably benign Het
Or5v1b C T 17: 37,841,597 (GRCm39) S243F probably damaging Het
Or7e174 A T 9: 20,012,165 (GRCm39) M37L probably benign Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Or8g23 T A 9: 38,971,729 (GRCm39) T78S probably damaging Het
Paf1 C A 7: 28,095,193 (GRCm39) probably null Het
Pcsk5 T C 19: 17,455,280 (GRCm39) D1050G probably benign Het
Pgap1 A G 1: 54,590,220 (GRCm39) S73P possibly damaging Het
Phtf1 G A 3: 103,911,799 (GRCm39) probably null Het
Pik3c2b G T 1: 132,994,282 (GRCm39) R82L probably damaging Het
Pik3ca T C 3: 32,504,206 (GRCm39) L632P probably damaging Het
Plau G T 14: 20,888,760 (GRCm39) probably null Het
Pld4 A T 12: 112,734,923 (GRCm39) Q460L possibly damaging Het
Prdm2 T A 4: 142,858,447 (GRCm39) Q1614H possibly damaging Het
Ptprq C T 10: 107,502,407 (GRCm39) G837D probably damaging Het
Rad9b A G 5: 122,477,842 (GRCm39) V178A possibly damaging Het
Rfc1 G T 5: 65,468,397 (GRCm39) Y105* probably null Het
Sardh G A 2: 27,118,351 (GRCm39) R460C probably damaging Het
Scn5a C A 9: 119,365,546 (GRCm39) R367L probably damaging Het
Sdcbp A T 4: 6,386,536 (GRCm39) I137L probably benign Het
Shmt2 A G 10: 127,355,029 (GRCm39) V273A probably benign Het
Slc5a9 G T 4: 111,737,423 (GRCm39) P612H probably benign Het
Slitrk4 TTGT TT X: 63,314,294 (GRCm39) probably null Het
Slitrk4 TG T X: 63,314,295 (GRCm39) probably null Het
Spata1 A T 3: 146,199,438 (GRCm39) S9T probably benign Het
Syn3 T C 10: 85,909,097 (GRCm39) T328A probably benign Het
Tdrd6 A G 17: 43,939,546 (GRCm39) F501L probably damaging Het
Tekt5 T C 16: 10,213,070 (GRCm39) I72V probably benign Het
Tlr6 T C 5: 65,110,748 (GRCm39) S720G probably damaging Het
Tmem156 T A 5: 65,237,294 (GRCm39) D87V probably damaging Het
Togaram1 T A 12: 65,065,914 (GRCm39) D1639E probably damaging Het
Ucn2 A G 9: 108,815,430 (GRCm39) K64R probably benign Het
Vmn2r57 T A 7: 41,098,001 (GRCm39) Y22F probably benign Het
Vwa1 T C 4: 155,855,307 (GRCm39) T269A probably benign Het
Washc5 A G 15: 59,213,004 (GRCm39) L892P possibly damaging Het
Wdr20 T C 12: 110,760,002 (GRCm39) V296A probably damaging Het
Xxylt1 A T 16: 30,869,586 (GRCm39) H171Q probably damaging Het
Yju2 C T 17: 56,271,543 (GRCm39) Q155* probably null Het
Zfp275 A G X: 72,396,841 (GRCm39) T118A possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACGGTTACAACTCACCATTTGC -3'
(R):5'- TGTGGGGAGACATCACATCC -3'

Sequencing Primer
(F):5'- CCATTTGCATCAAAAGTCACTTC -3'
(R):5'- CACATCCAGAATAATGTTCCTCTGG -3'
Posted On 2014-08-25