Incidental Mutation 'R2006:Mki67'
ID225561
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 040015-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R2006 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 135698509 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1599 (K1599*)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably null
Transcript: ENSMUST00000033310
AA Change: K1599*
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: K1599*

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,313,449 F333L probably benign Het
Abcc2 T A 19: 43,805,061 F384Y probably damaging Het
Acr C T 15: 89,574,201 P362S probably benign Het
Acss3 T C 10: 106,963,010 D484G possibly damaging Het
Actrt1 A G X: 46,329,716 T203A probably benign Het
Agtpbp1 A T 13: 59,500,321 C562S probably benign Het
Ahnak A G 19: 9,007,075 K1908E probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Apaf1 A T 10: 91,061,772 I283N probably damaging Het
Bbx G A 16: 50,224,395 T493M possibly damaging Het
Best2 C T 8: 85,013,189 probably null Het
C4bp C A 1: 130,648,032 E75* probably null Het
Calr3 A T 8: 72,434,851 V144D probably damaging Het
Capn1 C T 19: 5,991,583 G632D probably damaging Het
Catsper2 C A 2: 121,406,357 E270* probably null Het
Ccdc110 A T 8: 45,943,312 I747F probably damaging Het
Ccdc15 T A 9: 37,315,472 D389V possibly damaging Het
Ccdc94 C T 17: 55,964,543 Q155* probably null Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Crb2 A T 2: 37,783,434 D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 4,084,753 probably benign Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Dab1 T C 4: 104,605,325 I32T probably damaging Het
Daw1 T C 1: 83,191,345 V181A probably damaging Het
Dlg2 G A 7: 91,965,617 E255K possibly damaging Het
Dnah10 T A 5: 124,829,587 D4170E possibly damaging Het
Dnah12 A G 14: 26,814,459 T2111A possibly damaging Het
Dock10 T C 1: 80,549,789 Y1081C possibly damaging Het
Dscam T C 16: 96,819,912 Y532C probably damaging Het
Fam83c T C 2: 155,830,303 D404G probably benign Het
Fam83g A G 11: 61,702,975 N445S possibly damaging Het
Ghr C T 15: 3,327,982 C268Y probably damaging Het
Gm8444 T C 15: 81,843,574 probably benign Het
Gp6 T A 7: 4,384,989 K160N probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Gtf3c2 C A 5: 31,168,096 G450C probably damaging Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Il31ra T G 13: 112,530,356 Y396S probably damaging Het
Insig1 A G 5: 28,071,466 N10S probably benign Het
Kcnh2 C A 5: 24,326,570 G448C probably damaging Het
L1td1 C T 4: 98,733,489 S96L possibly damaging Het
Mapre3 A T 5: 30,861,824 N4I probably damaging Het
Mblac2 T A 13: 81,711,741 D70E probably benign Het
Mkl2 G T 16: 13,381,576 E98* probably null Het
Mpg A G 11: 32,231,840 I283V probably benign Het
Mybpc1 C A 10: 88,546,059 A576S probably damaging Het
Myo1h T G 5: 114,361,079 V129G probably damaging Het
Nars A T 18: 64,505,028 V285E probably damaging Het
Nbas T A 12: 13,414,741 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nyap1 T C 5: 137,735,691 H360R possibly damaging Het
Nyx A G X: 13,486,735 E276G probably damaging Het
Olfr111 C T 17: 37,530,706 S243F probably damaging Het
Olfr1129 T A 2: 87,575,192 M36K probably benign Het
Olfr1223 A T 2: 89,144,897 V42E probably benign Het
Olfr1231 A G 2: 89,302,816 Y259H possibly damaging Het
Olfr1361 T C 13: 21,658,472 T284A possibly damaging Het
Olfr168 A G 16: 19,530,705 Y72H probably benign Het
Olfr20 G T 11: 73,354,692 C313F probably benign Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr868 A T 9: 20,100,869 M37L probably benign Het
Olfr937 T A 9: 39,060,433 T78S probably damaging Het
Paf1 C A 7: 28,395,768 probably null Het
Pcsk5 T C 19: 17,477,916 D1050G probably benign Het
Pgap1 A G 1: 54,551,061 S73P possibly damaging Het
Phtf1 G A 3: 104,004,483 probably null Het
Pik3c2b G T 1: 133,066,544 R82L probably damaging Het
Pik3ca T C 3: 32,450,057 L632P probably damaging Het
Plau G T 14: 20,838,692 probably null Het
Pld4 A T 12: 112,768,489 Q460L possibly damaging Het
Prdm2 T A 4: 143,131,877 Q1614H possibly damaging Het
Ptprq C T 10: 107,666,546 G837D probably damaging Het
Rad9b A G 5: 122,339,779 V178A possibly damaging Het
Rfc1 G T 5: 65,311,054 Y105* probably null Het
Sardh G A 2: 27,228,339 R460C probably damaging Het
Scn5a C A 9: 119,536,480 R367L probably damaging Het
Sdcbp A T 4: 6,386,536 I137L probably benign Het
Shmt2 A G 10: 127,519,160 V273A probably benign Het
Slc5a9 G T 4: 111,880,226 P612H probably benign Het
Slitrk4 TTGT TT X: 64,270,688 probably null Het
Slitrk4 TG T X: 64,270,689 probably null Het
Spata1 A T 3: 146,493,683 S9T probably benign Het
Syn3 T C 10: 86,073,233 T328A probably benign Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Ticrr T C 7: 79,694,073 S1229P possibly damaging Het
Tlr6 T C 5: 64,953,405 S720G probably damaging Het
Tmem156 T A 5: 65,079,951 D87V probably damaging Het
Togaram1 T A 12: 65,019,140 D1639E probably damaging Het
Ucn2 A G 9: 108,986,362 K64R probably benign Het
Vmn2r57 T A 7: 41,448,577 Y22F probably benign Het
Vwa1 T C 4: 155,770,850 T269A probably benign Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wdr20 T C 12: 110,793,568 V296A probably damaging Het
Xxylt1 A T 16: 31,050,768 H171Q probably damaging Het
Zfp275 A G X: 73,353,235 T118A possibly damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
R7578:Mki67 UTSW 7 135700915 missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135699377 missense probably benign 0.01
R7646:Mki67 UTSW 7 135696769 missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135697426 missense probably damaging 1.00
R7691:Mki67 UTSW 7 135701992 missense not run
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTGATCTTCCAGCGGTTG -3'
(R):5'- CAAGAGGATGCGCTGTTCTTC -3'

Sequencing Primer
(F):5'- GGTAAGCCTAGTTCCATCTGCTG -3'
(R):5'- GGATGCGCTGTTCTTCAAAGGATAAC -3'
Posted On2014-08-25