Incidental Mutation 'R2006:Apaf1'
ID225589
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 040015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2006 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91061772 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 283 (I283N)
Ref Sequence ENSEMBL: ENSMUSP00000124134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000161987] [ENSMUST00000162618]
Predicted Effect probably damaging
Transcript: ENSMUST00000020157
AA Change: I294N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: I294N

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159110
AA Change: I294N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: I294N

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161987
SMART Domains Protein: ENSMUSP00000124422
Gene: ENSMUSG00000019979

DomainStartEndE-ValueType
Pfam:CARD 6 90 1e-21 PFAM
Pfam:NB-ARC 129 238 6.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162618
AA Change: I283N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: I283N

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,313,449 F333L probably benign Het
Abcc2 T A 19: 43,805,061 F384Y probably damaging Het
Acr C T 15: 89,574,201 P362S probably benign Het
Acss3 T C 10: 106,963,010 D484G possibly damaging Het
Actrt1 A G X: 46,329,716 T203A probably benign Het
Agtpbp1 A T 13: 59,500,321 C562S probably benign Het
Ahnak A G 19: 9,007,075 K1908E probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Bbx G A 16: 50,224,395 T493M possibly damaging Het
Best2 C T 8: 85,013,189 probably null Het
C4bp C A 1: 130,648,032 E75* probably null Het
Calr3 A T 8: 72,434,851 V144D probably damaging Het
Capn1 C T 19: 5,991,583 G632D probably damaging Het
Catsper2 C A 2: 121,406,357 E270* probably null Het
Ccdc110 A T 8: 45,943,312 I747F probably damaging Het
Ccdc15 T A 9: 37,315,472 D389V possibly damaging Het
Ccdc94 C T 17: 55,964,543 Q155* probably null Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Crb2 A T 2: 37,783,434 D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 4,084,753 probably benign Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Dab1 T C 4: 104,605,325 I32T probably damaging Het
Daw1 T C 1: 83,191,345 V181A probably damaging Het
Dlg2 G A 7: 91,965,617 E255K possibly damaging Het
Dnah10 T A 5: 124,829,587 D4170E possibly damaging Het
Dnah12 A G 14: 26,814,459 T2111A possibly damaging Het
Dock10 T C 1: 80,549,789 Y1081C possibly damaging Het
Dscam T C 16: 96,819,912 Y532C probably damaging Het
Fam83c T C 2: 155,830,303 D404G probably benign Het
Fam83g A G 11: 61,702,975 N445S possibly damaging Het
Ghr C T 15: 3,327,982 C268Y probably damaging Het
Gm8444 T C 15: 81,843,574 probably benign Het
Gp6 T A 7: 4,384,989 K160N probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Gtf3c2 C A 5: 31,168,096 G450C probably damaging Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Il31ra T G 13: 112,530,356 Y396S probably damaging Het
Insig1 A G 5: 28,071,466 N10S probably benign Het
Kcnh2 C A 5: 24,326,570 G448C probably damaging Het
L1td1 C T 4: 98,733,489 S96L possibly damaging Het
Mapre3 A T 5: 30,861,824 N4I probably damaging Het
Mblac2 T A 13: 81,711,741 D70E probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mkl2 G T 16: 13,381,576 E98* probably null Het
Mpg A G 11: 32,231,840 I283V probably benign Het
Mybpc1 C A 10: 88,546,059 A576S probably damaging Het
Myo1h T G 5: 114,361,079 V129G probably damaging Het
Nars A T 18: 64,505,028 V285E probably damaging Het
Nbas T A 12: 13,414,741 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nyap1 T C 5: 137,735,691 H360R possibly damaging Het
Nyx A G X: 13,486,735 E276G probably damaging Het
Olfr111 C T 17: 37,530,706 S243F probably damaging Het
Olfr1129 T A 2: 87,575,192 M36K probably benign Het
Olfr1223 A T 2: 89,144,897 V42E probably benign Het
Olfr1231 A G 2: 89,302,816 Y259H possibly damaging Het
Olfr1361 T C 13: 21,658,472 T284A possibly damaging Het
Olfr168 A G 16: 19,530,705 Y72H probably benign Het
Olfr20 G T 11: 73,354,692 C313F probably benign Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr868 A T 9: 20,100,869 M37L probably benign Het
Olfr937 T A 9: 39,060,433 T78S probably damaging Het
Paf1 C A 7: 28,395,768 probably null Het
Pcsk5 T C 19: 17,477,916 D1050G probably benign Het
Pgap1 A G 1: 54,551,061 S73P possibly damaging Het
Phtf1 G A 3: 104,004,483 probably null Het
Pik3c2b G T 1: 133,066,544 R82L probably damaging Het
Pik3ca T C 3: 32,450,057 L632P probably damaging Het
Plau G T 14: 20,838,692 probably null Het
Pld4 A T 12: 112,768,489 Q460L possibly damaging Het
Prdm2 T A 4: 143,131,877 Q1614H possibly damaging Het
Ptprq C T 10: 107,666,546 G837D probably damaging Het
Rad9b A G 5: 122,339,779 V178A possibly damaging Het
Rfc1 G T 5: 65,311,054 Y105* probably null Het
Sardh G A 2: 27,228,339 R460C probably damaging Het
Scn5a C A 9: 119,536,480 R367L probably damaging Het
Sdcbp A T 4: 6,386,536 I137L probably benign Het
Shmt2 A G 10: 127,519,160 V273A probably benign Het
Slc5a9 G T 4: 111,880,226 P612H probably benign Het
Slitrk4 TTGT TT X: 64,270,688 probably null Het
Slitrk4 TG T X: 64,270,689 probably null Het
Spata1 A T 3: 146,493,683 S9T probably benign Het
Syn3 T C 10: 86,073,233 T328A probably benign Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Ticrr T C 7: 79,694,073 S1229P possibly damaging Het
Tlr6 T C 5: 64,953,405 S720G probably damaging Het
Tmem156 T A 5: 65,079,951 D87V probably damaging Het
Togaram1 T A 12: 65,019,140 D1639E probably damaging Het
Ucn2 A G 9: 108,986,362 K64R probably benign Het
Vmn2r57 T A 7: 41,448,577 Y22F probably benign Het
Vwa1 T C 4: 155,770,850 T269A probably benign Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wdr20 T C 12: 110,793,568 V296A probably damaging Het
Xxylt1 A T 16: 31,050,768 H171Q probably damaging Het
Zfp275 A G X: 73,353,235 T118A possibly damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R0734:Apaf1 UTSW 10 91037021 missense probably benign 0.02
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
R7765:Apaf1 UTSW 10 91023782 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCACAAAGCAGGTTCCAGTG -3'
(R):5'- CAGTAATGGGTAAGGAGTTTCTGTC -3'

Sequencing Primer
(F):5'- CACAAAGCAGGTTCCAGTGTTGATG -3'
(R):5'- CTGGGATTAAAGTCATGCGCCAC -3'
Posted On2014-08-25