Incidental Mutation 'R2040:Ythdc2'
ID225598
Institutional Source Beutler Lab
Gene Symbol Ythdc2
Ensembl Gene ENSMUSG00000034653
Gene NameYTH domain containing 2
Synonyms3010002F02Rik
MMRRC Submission 040047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2040 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44827746-44889724 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 44855174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 16 (Y16*)
Ref Sequence ENSEMBL: ENSMUSP00000144479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]
Predicted Effect probably null
Transcript: ENSMUST00000037763
AA Change: Y671*
SMART Domains Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: Y671*

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
Pfam:R3H 59 119 1.7e-15 PFAM
DEXDc 206 393 4.95e-26 SMART
low complexity region 413 428 N/A INTRINSIC
ANK 521 550 2.79e1 SMART
ANK 554 583 1.5e2 SMART
HELICc 648 759 5.31e-17 SMART
HA2 823 916 2.58e-22 SMART
Pfam:OB_NTP_bind 953 1082 1.3e-18 PFAM
low complexity region 1263 1299 N/A INTRINSIC
Pfam:YTH 1303 1434 7.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000201507
AA Change: Y16*
SMART Domains Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653
AA Change: Y16*

DomainStartEndE-ValueType
HELICc 5 104 9.1e-19 SMART
HA2 168 261 2e-26 SMART
Pfam:OB_NTP_bind 298 427 6e-16 PFAM
low complexity region 570 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202176
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Pam T C 1: 97,864,442 E418G possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpn18 A G 1: 34,470,219 Q165R probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sept7 G A 9: 25,288,236 A144T possibly damaging Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vegfb T A 19: 6,986,039 H119L possibly damaging Het
Vmn2r111 T A 17: 22,548,414 I701F probably damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Ythdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ythdc2 APN 18 44859973 missense probably benign
IGL00341:Ythdc2 APN 18 44850397 missense probably benign 0.00
IGL00502:Ythdc2 APN 18 44847812 missense probably damaging 0.99
IGL00585:Ythdc2 APN 18 44864361 missense probably damaging 1.00
IGL01081:Ythdc2 APN 18 44850659 missense probably benign 0.19
IGL01569:Ythdc2 APN 18 44887651 missense probably benign
IGL01577:Ythdc2 APN 18 44858282 missense probably benign 0.00
IGL01617:Ythdc2 APN 18 44841415 missense possibly damaging 0.53
IGL01674:Ythdc2 APN 18 44860404 missense probably benign 0.04
IGL01736:Ythdc2 APN 18 44850668 missense probably damaging 0.97
IGL02095:Ythdc2 APN 18 44873140 splice site probably benign
IGL02245:Ythdc2 APN 18 44862684 missense possibly damaging 0.74
IGL02524:Ythdc2 APN 18 44847854 missense probably damaging 0.98
IGL02542:Ythdc2 APN 18 44840241 missense probably damaging 1.00
IGL02622:Ythdc2 APN 18 44859934 missense probably damaging 0.99
IGL02795:Ythdc2 APN 18 44837438 missense possibly damaging 0.95
IGL02935:Ythdc2 APN 18 44855045 missense probably damaging 1.00
PIT4618001:Ythdc2 UTSW 18 44834598 missense probably benign 0.19
R0115:Ythdc2 UTSW 18 44841423 splice site probably benign
R0329:Ythdc2 UTSW 18 44865060 splice site probably benign
R0472:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R0530:Ythdc2 UTSW 18 44850398 missense probably damaging 0.99
R0547:Ythdc2 UTSW 18 44840264 missense possibly damaging 0.92
R0563:Ythdc2 UTSW 18 44864848 splice site probably benign
R0609:Ythdc2 UTSW 18 44864357 missense probably benign 0.02
R1291:Ythdc2 UTSW 18 44855209 missense probably benign 0.33
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1469:Ythdc2 UTSW 18 44864462 missense probably benign 0.00
R1724:Ythdc2 UTSW 18 44828690 missense probably benign 0.04
R1860:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R2308:Ythdc2 UTSW 18 44847748 missense possibly damaging 0.95
R3711:Ythdc2 UTSW 18 44833173 missense probably damaging 0.98
R4005:Ythdc2 UTSW 18 44833128 missense probably benign 0.00
R4580:Ythdc2 UTSW 18 44858198 missense possibly damaging 0.81
R4631:Ythdc2 UTSW 18 44887631 missense probably benign 0.03
R4815:Ythdc2 UTSW 18 44885240 missense probably benign 0.40
R4924:Ythdc2 UTSW 18 44847804 missense probably damaging 1.00
R4982:Ythdc2 UTSW 18 44871465 missense probably benign 0.01
R5011:Ythdc2 UTSW 18 44854742 missense probably benign 0.38
R5141:Ythdc2 UTSW 18 44865047 missense probably benign 0.01
R5147:Ythdc2 UTSW 18 44844292 missense probably damaging 0.98
R5280:Ythdc2 UTSW 18 44860621 missense probably damaging 1.00
R5388:Ythdc2 UTSW 18 44857025 missense possibly damaging 0.65
R5928:Ythdc2 UTSW 18 44833205 missense probably benign
R5931:Ythdc2 UTSW 18 44872956 missense possibly damaging 0.86
R5995:Ythdc2 UTSW 18 44886253 missense probably damaging 1.00
R6027:Ythdc2 UTSW 18 44860436 missense probably benign 0.02
R6056:Ythdc2 UTSW 18 44840210 missense probably damaging 0.98
R6318:Ythdc2 UTSW 18 44860377 missense probably benign 0.04
R6399:Ythdc2 UTSW 18 44886402 missense possibly damaging 0.93
R6586:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R6684:Ythdc2 UTSW 18 44873069 missense possibly damaging 0.47
R7040:Ythdc2 UTSW 18 44834462 missense probably benign 0.02
R7071:Ythdc2 UTSW 18 44845788 missense probably benign 0.00
R7105:Ythdc2 UTSW 18 44834563 missense probably damaging 1.00
R7148:Ythdc2 UTSW 18 44833122 missense probably benign 0.42
R7290:Ythdc2 UTSW 18 44837491 missense possibly damaging 0.50
R7806:Ythdc2 UTSW 18 44844286 missense possibly damaging 0.91
R7806:Ythdc2 UTSW 18 44850424 missense probably benign 0.05
R8114:Ythdc2 UTSW 18 44877740 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATTTGAAAGAACTGGAGCAAACTGC -3'
(R):5'- GTGGAAAGGATCTGCAATGC -3'

Sequencing Primer
(F):5'- CGTATACCAATACTTGAACTCACATC -3'
(R):5'- CTATTTTTCGGACACCTGC -3'
Posted On2014-08-25