Incidental Mutation 'R2040:Vegfb'
ID225601
Institutional Source Beutler Lab
Gene Symbol Vegfb
Ensembl Gene ENSMUSG00000024962
Gene Namevascular endothelial growth factor B
SynonymsVrf, VEGF-B
MMRRC Submission 040047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2040 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6982473-6987651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6986039 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 119 (H119L)
Ref Sequence ENSEMBL: ENSMUSP00000120860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025914] [ENSMUST00000025915] [ENSMUST00000130048] [ENSMUST00000179118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025914
AA Change: H119L

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025914
Gene: ENSMUSG00000024962
AA Change: H119L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
low complexity region 182 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025915
SMART Domains Protein: ENSMUSP00000025915
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 160 179 N/A INTRINSIC
low complexity region 205 227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130048
AA Change: H119L

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120860
Gene: ENSMUSG00000024962
AA Change: H119L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
Pfam:VEGF_C 134 188 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147924
Predicted Effect probably benign
Transcript: ENSMUST00000179118
SMART Domains Protein: ENSMUSP00000136062
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 159 178 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Meta Mutation Damage Score 0.9197 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one or more disruptions in this gene display defective cardiac morphology and physiology, sensitivity to induced neurodegeneration, increased weight and brown adipose whitening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Pam T C 1: 97,864,442 E418G possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpn18 A G 1: 34,470,219 Q165R probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sept7 G A 9: 25,288,236 A144T possibly damaging Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vmn2r111 T A 17: 22,548,414 I701F probably damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Ythdc2 T A 18: 44,855,174 Y16* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Vegfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Vegfb APN 19 6986478 missense probably damaging 1.00
IGL02365:Vegfb APN 19 6985487 missense probably benign 0.19
IGL02431:Vegfb APN 19 6986018 splice site probably null
R2312:Vegfb UTSW 19 6985427 missense possibly damaging 0.63
R3777:Vegfb UTSW 19 6987399 unclassified probably benign
R4152:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R4154:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R5635:Vegfb UTSW 19 6982846 makesense probably null
R7804:Vegfb UTSW 19 6986339 missense probably damaging 1.00
R8348:Vegfb UTSW 19 6985488 missense probably benign 0.01
R8673:Vegfb UTSW 19 6985444 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACCTGTCTGGCTTCACAG -3'
(R):5'- ACAGTGATGTCCTATGGGCTGG -3'

Sequencing Primer
(F):5'- TTTTTGGTCTGAAAAGAGAGAGAGAG -3'
(R):5'- GGAGGGGCGTGCTGGAG -3'
Posted On2014-08-25