Incidental Mutation 'R2006:Pld4'
ID225610
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
MMRRC Submission 040015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2006 (G1)
Quality Score207
Status Not validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112768489 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 460 (Q460L)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888] [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063888
AA Change: Q460L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: Q460L

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,313,449 F333L probably benign Het
Abcc2 T A 19: 43,805,061 F384Y probably damaging Het
Acr C T 15: 89,574,201 P362S probably benign Het
Acss3 T C 10: 106,963,010 D484G possibly damaging Het
Actrt1 A G X: 46,329,716 T203A probably benign Het
Agtpbp1 A T 13: 59,500,321 C562S probably benign Het
Ahnak A G 19: 9,007,075 K1908E probably damaging Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Apaf1 A T 10: 91,061,772 I283N probably damaging Het
Bbx G A 16: 50,224,395 T493M possibly damaging Het
Best2 C T 8: 85,013,189 probably null Het
C4bp C A 1: 130,648,032 E75* probably null Het
Calr3 A T 8: 72,434,851 V144D probably damaging Het
Capn1 C T 19: 5,991,583 G632D probably damaging Het
Catsper2 C A 2: 121,406,357 E270* probably null Het
Ccdc110 A T 8: 45,943,312 I747F probably damaging Het
Ccdc15 T A 9: 37,315,472 D389V possibly damaging Het
Ccdc94 C T 17: 55,964,543 Q155* probably null Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Crb2 A T 2: 37,783,434 D114V probably damaging Het
Crebbp TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 16: 4,084,753 probably benign Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Dab1 T C 4: 104,605,325 I32T probably damaging Het
Daw1 T C 1: 83,191,345 V181A probably damaging Het
Dlg2 G A 7: 91,965,617 E255K possibly damaging Het
Dnah10 T A 5: 124,829,587 D4170E possibly damaging Het
Dnah12 A G 14: 26,814,459 T2111A possibly damaging Het
Dock10 T C 1: 80,549,789 Y1081C possibly damaging Het
Dscam T C 16: 96,819,912 Y532C probably damaging Het
Fam83c T C 2: 155,830,303 D404G probably benign Het
Fam83g A G 11: 61,702,975 N445S possibly damaging Het
Ghr C T 15: 3,327,982 C268Y probably damaging Het
Gm8444 T C 15: 81,843,574 probably benign Het
Gp6 T A 7: 4,384,989 K160N probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Gtf3c2 C A 5: 31,168,096 G450C probably damaging Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Il31ra T G 13: 112,530,356 Y396S probably damaging Het
Insig1 A G 5: 28,071,466 N10S probably benign Het
Kcnh2 C A 5: 24,326,570 G448C probably damaging Het
L1td1 C T 4: 98,733,489 S96L possibly damaging Het
Mapre3 A T 5: 30,861,824 N4I probably damaging Het
Mblac2 T A 13: 81,711,741 D70E probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mkl2 G T 16: 13,381,576 E98* probably null Het
Mpg A G 11: 32,231,840 I283V probably benign Het
Mybpc1 C A 10: 88,546,059 A576S probably damaging Het
Myo1h T G 5: 114,361,079 V129G probably damaging Het
Nars A T 18: 64,505,028 V285E probably damaging Het
Nbas T A 12: 13,414,741 probably null Het
Neb T C 2: 52,199,444 D5172G probably null Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nyap1 T C 5: 137,735,691 H360R possibly damaging Het
Nyx A G X: 13,486,735 E276G probably damaging Het
Olfr111 C T 17: 37,530,706 S243F probably damaging Het
Olfr1129 T A 2: 87,575,192 M36K probably benign Het
Olfr1223 A T 2: 89,144,897 V42E probably benign Het
Olfr1231 A G 2: 89,302,816 Y259H possibly damaging Het
Olfr1361 T C 13: 21,658,472 T284A possibly damaging Het
Olfr168 A G 16: 19,530,705 Y72H probably benign Het
Olfr20 G T 11: 73,354,692 C313F probably benign Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr868 A T 9: 20,100,869 M37L probably benign Het
Olfr937 T A 9: 39,060,433 T78S probably damaging Het
Paf1 C A 7: 28,395,768 probably null Het
Pcsk5 T C 19: 17,477,916 D1050G probably benign Het
Pgap1 A G 1: 54,551,061 S73P possibly damaging Het
Phtf1 G A 3: 104,004,483 probably null Het
Pik3c2b G T 1: 133,066,544 R82L probably damaging Het
Pik3ca T C 3: 32,450,057 L632P probably damaging Het
Plau G T 14: 20,838,692 probably null Het
Prdm2 T A 4: 143,131,877 Q1614H possibly damaging Het
Ptprq C T 10: 107,666,546 G837D probably damaging Het
Rad9b A G 5: 122,339,779 V178A possibly damaging Het
Rfc1 G T 5: 65,311,054 Y105* probably null Het
Sardh G A 2: 27,228,339 R460C probably damaging Het
Scn5a C A 9: 119,536,480 R367L probably damaging Het
Sdcbp A T 4: 6,386,536 I137L probably benign Het
Shmt2 A G 10: 127,519,160 V273A probably benign Het
Slc5a9 G T 4: 111,880,226 P612H probably benign Het
Slitrk4 TTGT TT X: 64,270,688 probably null Het
Slitrk4 TG T X: 64,270,689 probably null Het
Spata1 A T 3: 146,493,683 S9T probably benign Het
Syn3 T C 10: 86,073,233 T328A probably benign Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Ticrr T C 7: 79,694,073 S1229P possibly damaging Het
Tlr6 T C 5: 64,953,405 S720G probably damaging Het
Tmem156 T A 5: 65,079,951 D87V probably damaging Het
Togaram1 T A 12: 65,019,140 D1639E probably damaging Het
Ucn2 A G 9: 108,986,362 K64R probably benign Het
Vmn2r57 T A 7: 41,448,577 Y22F probably benign Het
Vwa1 T C 4: 155,770,850 T269A probably benign Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wdr20 T C 12: 110,793,568 V296A probably damaging Het
Xxylt1 A T 16: 31,050,768 H171Q probably damaging Het
Zfp275 A G X: 73,353,235 T118A possibly damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7864:Pld4 UTSW 12 112765123 missense probably damaging 1.00
R8792:Pld4 UTSW 12 112763490 missense probably benign 0.00
R8826:Pld4 UTSW 12 112766776 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTACATCTAAACGAGGGGCTG -3'
(R):5'- TCTAGAGCTGTAGGCCAGAATC -3'

Sequencing Primer
(F):5'- TCTGATGGCAGCACAGAGGTC -3'
(R):5'- CTGTAGGCCAGAATCAAAGGGATC -3'
Posted On2014-08-25