Incidental Mutation 'R0145:Vgf'
ID22562
Institutional Source Beutler Lab
Gene Symbol Vgf
Ensembl Gene ENSMUSG00000037428
Gene NameVGF nerve growth factor inducible
SynonymsLOC381677
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0145 (G1) of strain 722
Quality Score198
Status Validated (trace)
Chromosome5
Chromosomal Location137026392-137033351 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 137031482 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000186451] [ENSMUST00000187382] [ENSMUST00000190827]
Predicted Effect unknown
Transcript: ENSMUST00000041543
AA Change: L166H
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428
AA Change: L166H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect unknown
Transcript: ENSMUST00000186451
AA Change: L166H
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428
AA Change: L166H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187382
SMART Domains Protein: ENSMUSP00000140093
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190827
AA Change: L166H
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428
AA Change: L166H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small, lean, hyperactive, hypermetabolic, and infertile. Mutants exhibit markedly reduced leptin levels and altered hypothalamic proopiomelanocortin, neuropeptide Y, and agouti-related peptide expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Vgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1832:Vgf UTSW 5 137031299 missense possibly damaging 0.46
R1960:Vgf UTSW 5 137032175 unclassified probably benign
R2256:Vgf UTSW 5 137031547 unclassified probably benign
R3433:Vgf UTSW 5 137031019 missense probably benign 0.27
R4751:Vgf UTSW 5 137032401 missense probably damaging 0.99
R5304:Vgf UTSW 5 137032286 missense probably damaging 0.96
R6874:Vgf UTSW 5 137031532 unclassified probably benign
R6944:Vgf UTSW 5 137032352 missense probably damaging 0.99
R6969:Vgf UTSW 5 137031653 unclassified probably benign
R7499:Vgf UTSW 5 137032245 missense probably damaging 0.99
R7511:Vgf UTSW 5 137031391 missense unknown
R7791:Vgf UTSW 5 137032031 missense unknown
R8356:Vgf UTSW 5 137032411 missense probably damaging 0.97
R8456:Vgf UTSW 5 137032411 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCTGAGCATAATGGGCAGGTAGC -3'
(R):5'- ACATTCGAGCCTGGAATTGGGAAG -3'

Sequencing Primer
(F):5'- TACTGTTGCAGGCACTGGAC -3'
(R):5'- CCTGGAATTGGGAAGGGACC -3'
Posted On2013-04-16