Incidental Mutation 'R1995:Olfr1122'
ID 225657
Institutional Source Beutler Lab
Gene Symbol Olfr1122
Ensembl Gene ENSMUSG00000047594
Gene Name olfactory receptor 1122
Synonyms GA_x6K02T2Q125-48880078-48881058, MOR264-1
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87385849-87391930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 87387831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 42 (I42R)
Ref Sequence ENSEMBL: ENSMUSP00000149403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056435] [ENSMUST00000215371]
AlphaFold Q8VGT9
Predicted Effect probably damaging
Transcript: ENSMUST00000056435
AA Change: I42R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052190
Gene: ENSMUSG00000047594
AA Change: I42R

DomainStartEndE-ValueType
Pfam:7tm_4 43 319 6.3e-51 PFAM
Pfam:7tm_1 53 302 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215371
AA Change: I42R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Olfr1122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1122 APN 2 87387838 missense probably benign 0.39
IGL01783:Olfr1122 APN 2 87387843 missense possibly damaging 0.91
IGL02396:Olfr1122 APN 2 87387705 utr 5 prime probably benign
IGL03338:Olfr1122 APN 2 87388126 missense probably benign 0.05
IGL03373:Olfr1122 APN 2 87388233 missense probably damaging 1.00
R0594:Olfr1122 UTSW 2 87387954 missense probably damaging 1.00
R1245:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1471:Olfr1122 UTSW 2 87388518 missense probably damaging 1.00
R1681:Olfr1122 UTSW 2 87388620 missense possibly damaging 0.95
R2246:Olfr1122 UTSW 2 87387851 missense probably benign 0.00
R2341:Olfr1122 UTSW 2 87387740 missense probably benign
R4008:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4009:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4011:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4119:Olfr1122 UTSW 2 87387843 missense possibly damaging 0.91
R4547:Olfr1122 UTSW 2 87388160 missense probably benign 0.07
R4665:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4666:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4801:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R4802:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R5049:Olfr1122 UTSW 2 87388658 missense probably benign 0.00
R5070:Olfr1122 UTSW 2 87388163 missense probably damaging 1.00
R7594:Olfr1122 UTSW 2 87388269 missense probably damaging 1.00
R7684:Olfr1122 UTSW 2 87388028 missense probably damaging 0.99
R8064:Olfr1122 UTSW 2 87388509 missense probably benign 0.00
R8218:Olfr1122 UTSW 2 87388578 missense probably damaging 0.99
R8282:Olfr1122 UTSW 2 87388508 missense probably benign 0.01
R8335:Olfr1122 UTSW 2 87387860 missense probably benign 0.02
R9800:Olfr1122 UTSW 2 87388164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCATCAGGCCAGCAAAG -3'
(R):5'- TGCCTCCAAGCATGATGAC -3'

Sequencing Primer
(F):5'- GCAAAGAAGCTGGGAGATTTTAAG -3'
(R):5'- CATGATGACAAAACAGAGCTGTAC -3'
Posted On 2014-08-25