Incidental Mutation 'R1995:Gria2'
ID225661
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80802357 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 10 (L10F)
Ref Sequence ENSEMBL: ENSMUSP00000141447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect probably benign
Transcript: ENSMUST00000075316
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: L10F

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107745
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: L10F

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192463
AA Change: L10F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: L10F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195062
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
R7191:Gria2 UTSW 3 80732085 missense probably benign 0.24
R7225:Gria2 UTSW 3 80802631 unclassified probably benign
R7374:Gria2 UTSW 3 80741076 missense probably benign
R7837:Gria2 UTSW 3 80710788 missense probably benign 0.18
R7920:Gria2 UTSW 3 80710788 missense probably benign 0.18
R8034:Gria2 UTSW 3 80801699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTCTATTGTGTCAAAAGGC -3'
(R):5'- ACTTCGTGGTTTTAGCAGCTCC -3'

Sequencing Primer
(F):5'- GTTTCAATCTGGAATGCAGTCAAGG -3'
(R):5'- CTTGCTAAATTTCGACCTCAAAATGC -3'
Posted On2014-08-25