Incidental Mutation 'R1995:Gucy1b1'
ID225662
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Nameguanylate cyclase 1, soluble, beta 1
Synonymsbeta 1 sGC
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82032006-82074689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82034853 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 533 (I533T)
Ref Sequence ENSEMBL: ENSMUSP00000142119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
Predicted Effect probably damaging
Transcript: ENSMUST00000029635
AA Change: I533T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: I533T

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192508
Predicted Effect probably damaging
Transcript: ENSMUST00000193597
AA Change: I533T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: I533T

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 82034862 missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 82034868 missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 82035285 missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 82046526 missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 82058329 missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 82039861 missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 82034878 missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 82034391 missense probably benign
R0126:Gucy1b1 UTSW 3 82037911 splice site probably benign
R0277:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 82045460 missense probably benign 0.02
R0691:Gucy1b1 UTSW 3 82045634 splice site probably benign
R0811:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 82045460 missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 82038042 missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 82058352 missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 82045409 missense probably benign 0.43
R2156:Gucy1b1 UTSW 3 82061020 missense probably benign
R2441:Gucy1b1 UTSW 3 82045454 missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 82046667 missense probably benign 0.43
R5397:Gucy1b1 UTSW 3 82044151 missense possibly damaging 0.92
R5494:Gucy1b1 UTSW 3 82039876 missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 82058277 missense probably damaging 1.00
R6088:Gucy1b1 UTSW 3 82034880 missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 82046713 splice site probably null
R6331:Gucy1b1 UTSW 3 82034411 missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 82034408 missense probably benign
R6753:Gucy1b1 UTSW 3 82039747 missense probably null 0.03
R7150:Gucy1b1 UTSW 3 82043162 missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 82033274 missense unknown
R7461:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 82035359 missense probably damaging 1.00
R7613:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7791:Gucy1b1 UTSW 3 82035397 nonsense probably null
Z1177:Gucy1b1 UTSW 3 82061112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCAAAAGCACACAGTC -3'
(R):5'- TGTGGATGAGGAAAGCTCCC -3'

Sequencing Primer
(F):5'- GTCCACTCGCAAGGTACCAG -3'
(R):5'- GGATGAGGAAAGCTCCCAATATTTC -3'
Posted On2014-08-25