Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Gucy1b1'

225662

Institutional Source

Beutler Lab

Gene Symbol

Gucy1b1

Ensembl Gene

ENSMUSG00000028005

Gene Name

guanylate cyclase 1, soluble, beta 1

Synonyms

beta 1 sGC

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82032006-82074689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82034853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 533 (I533T)

Ref Sequence

ENSEMBL: ENSMUSP00000142119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]

AlphaFold

O54865

Predicted Effect

probably damaging
Transcript: ENSMUST00000029635
AA Change: I533T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005
AA Change: I533T

Domain	Start	End	E-Value	Type
Pfam:HNOB	2	166	3.4e-58	PFAM
low complexity region	182	189	N/A	INTRINSIC
PDB:4GJ4\|D	212	343	9e-16	PDB
CYCc	385	586	3.53e-93	SMART
low complexity region	608	620	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192508

Predicted Effect

probably damaging
Transcript: ENSMUST00000193597
AA Change: I533T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005
AA Change: I533T

Domain	Start	End	E-Value	Type
Pfam:HNOB	1	172	1.5e-67	PFAM
low complexity region	182	189	N/A	INTRINSIC
PDB:4GJ4\|D	212	343	9e-16	PDB
CYCc	385	582	1.71e-91	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Gucy1b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Gucy1b1	APN	3	82034862	missense	probably damaging	1.00
IGL01602:Gucy1b1	APN	3	82035353	missense	probably benign	0.17
IGL01603:Gucy1b1	APN	3	82034868	missense	probably damaging	0.98
IGL01605:Gucy1b1	APN	3	82035353	missense	probably benign	0.17
IGL01685:Gucy1b1	APN	3	82035285	missense	probably benign	0.27
IGL01844:Gucy1b1	APN	3	82046526	missense	possibly damaging	0.95
IGL02566:Gucy1b1	APN	3	82058329	missense	probably damaging	1.00
R0014:Gucy1b1	UTSW	3	82039861	missense	probably damaging	1.00
R0068:Gucy1b1	UTSW	3	82034878	missense	probably benign	0.34
R0115:Gucy1b1	UTSW	3	82034391	missense	probably benign
R0126:Gucy1b1	UTSW	3	82037911	splice site	probably benign
R0277:Gucy1b1	UTSW	3	82038156	critical splice acceptor site	probably null
R0323:Gucy1b1	UTSW	3	82038156	critical splice acceptor site	probably null
R0633:Gucy1b1	UTSW	3	82045460	missense	probably benign	0.02
R0691:Gucy1b1	UTSW	3	82045634	splice site	probably benign
R0811:Gucy1b1	UTSW	3	82037988	missense	probably benign	0.04
R0812:Gucy1b1	UTSW	3	82037988	missense	probably benign	0.04
R1670:Gucy1b1	UTSW	3	82045460	missense	probably benign	0.10
R1687:Gucy1b1	UTSW	3	82038042	missense	probably damaging	1.00
R1856:Gucy1b1	UTSW	3	82058352	missense	probably benign	0.00
R1950:Gucy1b1	UTSW	3	82045409	missense	probably benign	0.43
R2156:Gucy1b1	UTSW	3	82061020	missense	probably benign
R2441:Gucy1b1	UTSW	3	82045454	missense	probably damaging	0.98
R5014:Gucy1b1	UTSW	3	82046667	missense	probably benign	0.43
R5397:Gucy1b1	UTSW	3	82044151	missense	possibly damaging	0.92
R5494:Gucy1b1	UTSW	3	82039876	missense	probably damaging	1.00
R6003:Gucy1b1	UTSW	3	82058277	missense	probably damaging	1.00
R6088:Gucy1b1	UTSW	3	82034880	missense	probably damaging	1.00
R6216:Gucy1b1	UTSW	3	82046713	splice site	probably null
R6331:Gucy1b1	UTSW	3	82034411	missense	possibly damaging	0.75
R6671:Gucy1b1	UTSW	3	82034408	missense	probably benign
R6753:Gucy1b1	UTSW	3	82039747	missense	probably null	0.03
R7150:Gucy1b1	UTSW	3	82043162	missense	probably damaging	1.00
R7228:Gucy1b1	UTSW	3	82033274	missense	unknown
R7461:Gucy1b1	UTSW	3	82039747	missense	possibly damaging	0.74
R7501:Gucy1b1	UTSW	3	82035359	missense	probably damaging	1.00
R7613:Gucy1b1	UTSW	3	82039747	missense	possibly damaging	0.74
R7791:Gucy1b1	UTSW	3	82035397	nonsense	probably null
R8560:Gucy1b1	UTSW	3	82035378	missense	probably damaging	0.98
R9312:Gucy1b1	UTSW	3	82034816	missense	probably damaging	1.00
R9553:Gucy1b1	UTSW	3	82039780	missense	probably damaging	1.00
R9559:Gucy1b1	UTSW	3	82039747	missense	possibly damaging	0.74
R9762:Gucy1b1	UTSW	3	82034758	missense	possibly damaging	0.76
Z1177:Gucy1b1	UTSW	3	82061112	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAGCAAAAGCACACAGTC -3'
(R):5'- TGTGGATGAGGAAAGCTCCC -3'

Sequencing Primer
(F):5'- GTCCACTCGCAAGGTACCAG -3'
(R):5'- GGATGAGGAAAGCTCCCAATATTTC -3'

Posted On

2014-08-25