Incidental Mutation 'R1995:Kirrel'
ID 225663
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms Kirrel1, 6720469N11Rik, Neph1
MMRRC Submission 040005-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 87078593-87174747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87095786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 100 (A100D)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect possibly damaging
Transcript: ENSMUST00000041732
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: A100D

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107618
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: A100D

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159976
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: A100D

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1876:Kirrel UTSW 3 87089151 missense probably null 0.46
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3911:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4067:Kirrel UTSW 3 87088467 nonsense probably null
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4198:Kirrel UTSW 3 87089151 missense probably null 0.46
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4460:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
R7199:Kirrel UTSW 3 87083388 missense probably benign 0.02
R7221:Kirrel UTSW 3 87086397 nonsense probably null
R7284:Kirrel UTSW 3 87083387 missense probably benign 0.02
R7332:Kirrel UTSW 3 87088398 missense probably benign 0.14
R7369:Kirrel UTSW 3 87141084 missense probably benign 0.20
R7371:Kirrel UTSW 3 87088422 missense probably benign 0.44
R7508:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R7566:Kirrel UTSW 3 87088484 missense probably damaging 1.00
R7567:Kirrel UTSW 3 87095681 missense probably damaging 0.99
R7621:Kirrel UTSW 3 87088221 missense possibly damaging 0.70
R8030:Kirrel UTSW 3 87097775 missense probably damaging 1.00
R8141:Kirrel UTSW 3 87086428 nonsense probably null
R8261:Kirrel UTSW 3 87088002 intron probably benign
R8477:Kirrel UTSW 3 87084831 missense possibly damaging 0.71
R8512:Kirrel UTSW 3 87088227 missense probably benign 0.00
R8954:Kirrel UTSW 3 87089866 missense probably benign 0.25
R8987:Kirrel UTSW 3 87085093 missense probably damaging 1.00
R9058:Kirrel UTSW 3 87085135 missense probably benign 0.18
R9146:Kirrel UTSW 3 87095708 missense probably damaging 1.00
R9311:Kirrel UTSW 3 87097816 missense probably benign 0.29
R9527:Kirrel UTSW 3 87089605 nonsense probably null
R9629:Kirrel UTSW 3 87095718 nonsense probably null
Z1177:Kirrel UTSW 3 87083875 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGAAAATGAGAAACCCAGCTTG -3'
(R):5'- TTTCGGTCCCACAGCTATGG -3'

Sequencing Primer
(F):5'- AGCTTGGGAGTCATTACTGAGCAC -3'
(R):5'- CCACAGCTATGGAGTCTGTGTC -3'
Posted On 2014-08-25