Incidental Mutation 'R1995:Pogz'
ID 225666
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Name pogo transposable element with ZNF domain
Synonyms 9530006B08Rik
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.771) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 94744878-94789637 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94785255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 793 (R793W)
Ref Sequence ENSEMBL: ENSMUSP00000102891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
AlphaFold Q8BZH4
Predicted Effect probably damaging
Transcript: ENSMUST00000042402
AA Change: R784W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: R784W

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107266
AA Change: R740W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: R740W

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107269
AA Change: R698W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: R698W

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107270
AA Change: R793W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: R793W

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,678,872 (GRCm39) K145N probably damaging Het
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Btbd9 A G 17: 30,493,904 (GRCm39) Y496H possibly damaging Het
Catsperb T A 12: 101,569,026 (GRCm39) N899K possibly damaging Het
Cenpl T C 1: 160,905,994 (GRCm39) S123P probably damaging Het
Cep120 G A 18: 53,873,208 (GRCm39) T41I probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 (GRCm39) P105S possibly damaging Het
Col6a1 T C 10: 76,557,790 (GRCm39) N149D probably damaging Het
Ctnna3 T A 10: 63,656,143 (GRCm39) V241D probably damaging Het
Dcbld2 A C 16: 58,276,695 (GRCm39) E495D probably benign Het
Dmp1 T G 5: 104,357,779 (GRCm39) S40A possibly damaging Het
Dpysl4 A G 7: 138,676,686 (GRCm39) I379V probably benign Het
Eral1 C T 11: 77,965,315 (GRCm39) G367S probably benign Het
Fah C T 7: 84,251,389 (GRCm39) R31Q probably damaging Het
Fbn1 T A 2: 125,192,293 (GRCm39) probably null Het
Fbxo40 T C 16: 36,790,231 (GRCm39) D293G probably damaging Het
Gemin6 A C 17: 80,535,414 (GRCm39) T125P probably damaging Het
Gpbar1 G A 1: 74,318,603 (GRCm39) G282D possibly damaging Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gucy1b1 A G 3: 81,942,160 (GRCm39) I533T probably damaging Het
H2-M9 A T 17: 36,952,678 (GRCm39) Y123N probably damaging Het
Hipk2 C A 6: 38,692,909 (GRCm39) D868Y probably damaging Het
Itprid1 T C 6: 55,945,694 (GRCm39) I805T probably benign Het
Jarid2 T C 13: 45,027,917 (GRCm39) L123P probably damaging Het
Kcnb2 C A 1: 15,779,990 (GRCm39) N287K possibly damaging Het
Kdm8 G A 7: 125,051,511 (GRCm39) G35S probably benign Het
Kirrel1 G T 3: 87,003,093 (GRCm39) A100D possibly damaging Het
Ltbp2 T G 12: 84,855,220 (GRCm39) probably null Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Neb C T 2: 52,188,744 (GRCm39) V837M probably damaging Het
Nkain2 A G 10: 32,278,347 (GRCm39) I26T possibly damaging Het
Nuggc A G 14: 65,848,623 (GRCm39) R175G probably benign Het
Or10ag57 T G 2: 87,218,175 (GRCm39) I42R probably damaging Het
Or5ac23 A G 16: 59,149,654 (GRCm39) S73P probably damaging Het
Or5d35 T A 2: 87,856,016 (GRCm39) S317T probably benign Het
Or8g52 T C 9: 39,630,709 (GRCm39) F62S probably damaging Het
Pcnt G A 10: 76,228,633 (GRCm39) Q1511* probably null Het
Piezo2 G T 18: 63,211,852 (GRCm39) T1311K probably damaging Het
Pik3c2a T C 7: 115,953,241 (GRCm39) Y1218C probably damaging Het
Pik3r4 T A 9: 105,546,364 (GRCm39) S905T probably benign Het
Pikfyve T A 1: 65,285,867 (GRCm39) D1035E probably damaging Het
Pkn3 G C 2: 29,979,989 (GRCm39) G744A probably damaging Het
Pms1 A G 1: 53,234,174 (GRCm39) S781P probably benign Het
Prrc2a A T 17: 35,376,405 (GRCm39) V795D probably damaging Het
Rock1 G A 18: 10,101,026 (GRCm39) R630* probably null Het
Scd4 T A 19: 44,322,617 (GRCm39) I70N possibly damaging Het
Serpine2 A G 1: 79,799,159 (GRCm39) S32P probably damaging Het
Slc9c1 A C 16: 45,374,618 (GRCm39) T328P probably damaging Het
Spata31d1b G C 13: 59,864,194 (GRCm39) L447F probably benign Het
Speer2 A G 16: 69,654,965 (GRCm39) S167P probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Tbcel C A 9: 42,362,957 (GRCm39) G29W probably damaging Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Tmem240 T A 4: 155,824,304 (GRCm39) D125E possibly damaging Het
Ttll7 G A 3: 146,667,510 (GRCm39) C792Y possibly damaging Het
Vmn1r177 T A 7: 23,565,112 (GRCm39) I255F probably damaging Het
Zp2 T A 7: 119,734,388 (GRCm39) I554F probably damaging Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94,782,014 (GRCm39) unclassified probably benign
IGL02225:Pogz APN 3 94,786,327 (GRCm39) missense probably damaging 0.99
IGL02377:Pogz APN 3 94,786,321 (GRCm39) missense probably damaging 1.00
IGL02468:Pogz APN 3 94,786,394 (GRCm39) missense probably damaging 0.97
IGL02672:Pogz APN 3 94,763,410 (GRCm39) missense probably benign 0.08
IGL03290:Pogz APN 3 94,782,402 (GRCm39) unclassified probably benign
FR4976:Pogz UTSW 3 94,782,006 (GRCm39) unclassified probably benign
PIT4382001:Pogz UTSW 3 94,787,107 (GRCm39) missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94,779,681 (GRCm39) missense probably damaging 1.00
R0326:Pogz UTSW 3 94,777,424 (GRCm39) missense probably damaging 1.00
R0401:Pogz UTSW 3 94,784,336 (GRCm39) missense possibly damaging 0.81
R0479:Pogz UTSW 3 94,783,947 (GRCm39) missense possibly damaging 0.92
R0586:Pogz UTSW 3 94,786,664 (GRCm39) missense probably damaging 1.00
R1349:Pogz UTSW 3 94,768,199 (GRCm39) missense probably damaging 1.00
R1372:Pogz UTSW 3 94,768,199 (GRCm39) missense probably damaging 1.00
R1670:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1780:Pogz UTSW 3 94,777,437 (GRCm39) missense possibly damaging 0.54
R1854:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1855:Pogz UTSW 3 94,786,160 (GRCm39) missense probably benign 0.21
R1964:Pogz UTSW 3 94,785,504 (GRCm39) missense probably benign 0.36
R2109:Pogz UTSW 3 94,786,276 (GRCm39) missense probably benign
R2139:Pogz UTSW 3 94,778,318 (GRCm39) missense possibly damaging 0.95
R4457:Pogz UTSW 3 94,763,374 (GRCm39) missense probably benign 0.14
R4598:Pogz UTSW 3 94,787,491 (GRCm39) missense possibly damaging 0.52
R5598:Pogz UTSW 3 94,771,820 (GRCm39) missense probably damaging 1.00
R5999:Pogz UTSW 3 94,763,428 (GRCm39) missense possibly damaging 0.77
R6104:Pogz UTSW 3 94,787,342 (GRCm39) missense probably benign 0.09
R7017:Pogz UTSW 3 94,761,335 (GRCm39) missense probably damaging 0.99
R7632:Pogz UTSW 3 94,763,517 (GRCm39) splice site probably null
R7788:Pogz UTSW 3 94,782,544 (GRCm39) missense probably damaging 0.99
R7810:Pogz UTSW 3 94,777,418 (GRCm39) missense probably benign 0.00
R8396:Pogz UTSW 3 94,786,061 (GRCm39) missense probably benign 0.00
R8681:Pogz UTSW 3 94,768,234 (GRCm39) missense probably damaging 1.00
R8981:Pogz UTSW 3 94,786,226 (GRCm39) missense probably damaging 0.96
R8982:Pogz UTSW 3 94,786,879 (GRCm39) missense probably damaging 1.00
R9024:Pogz UTSW 3 94,785,543 (GRCm39) missense probably damaging 1.00
R9056:Pogz UTSW 3 94,787,530 (GRCm39) missense probably benign 0.02
R9316:Pogz UTSW 3 94,784,659 (GRCm39) missense probably damaging 1.00
RF014:Pogz UTSW 3 94,785,558 (GRCm39) missense possibly damaging 0.77
Z1088:Pogz UTSW 3 94,786,387 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGGAGCTTGTTAGAAATGC -3'
(R):5'- AGGCCAGCTTGATTCCACTG -3'

Sequencing Primer
(F):5'- GGGAGCTTGTTAGAAATGCTAATCC -3'
(R):5'- CAGCTTGATTCCACTGTGGGAAG -3'
Posted On 2014-08-25