Incidental Mutation 'R1995:Ttll7'
ID225668
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Nametubulin tyrosine ligase-like family, member 7
Synonyms1110049N09Rik, 4921517B04Rik
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146852367-146984009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146961755 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 792 (C792Y)
Ref Sequence ENSEMBL: ENSMUSP00000129369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037942
AA Change: C812Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000106134
AA Change: C787Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: C787Y

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170055
AA Change: C792Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: C792Y

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197547
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146909582 missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146961719 missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146909599 missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146940021 missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146896690 missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146909653 missense probably benign 0.06
P0038:Ttll7 UTSW 3 146945184 missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146944160 nonsense probably null
R0358:Ttll7 UTSW 3 146944116 missense probably benign
R0363:Ttll7 UTSW 3 146944215 missense probably benign 0.00
R0364:Ttll7 UTSW 3 146945181 missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146896667 missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146894405 missense probably benign 0.02
R1789:Ttll7 UTSW 3 146915780 missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146915795 splice site probably benign
R2083:Ttll7 UTSW 3 146930104 missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146930189 missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146947621 missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146930415 nonsense probably null
R4888:Ttll7 UTSW 3 146894177 start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146894469 missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146961710 missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146944092 nonsense probably null
R6009:Ttll7 UTSW 3 146934535 missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6463:Ttll7 UTSW 3 146931582 missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146944056 missense probably benign 0.02
R6922:Ttll7 UTSW 3 146909614 missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146913296 missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146913276 missense probably damaging 0.97
RF015:Ttll7 UTSW 3 146979658 missense probably benign 0.00
X0024:Ttll7 UTSW 3 146909553 missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146961695 missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146947653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACATGTGCATGCTGC -3'
(R):5'- TCGTCCAAATCAACTTAGTTGC -3'

Sequencing Primer
(F):5'- GGCAGGAGATGACACTTACCTTTC -3'
(R):5'- CCATTTCCATGGTCTAGCT -3'
Posted On2014-08-25