Mutagenetix > Incidental Mutations

Incidental Mutation 'R1995:Ttll7'

225668

Institutional Source

Beutler Lab

Gene Symbol

Ttll7

Ensembl Gene

ENSMUSG00000036745

Gene Name

tubulin tyrosine ligase-like family, member 7

Synonyms

1110049N09Rik, 4921517B04Rik

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.543) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146852367-146984009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 146961755 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 792 (C792Y)

Ref Sequence

ENSEMBL: ENSMUSP00000129369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037942
AA Change: C812Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106134
AA Change: C787Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: C787Y

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	7.2e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170055
AA Change: C792Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: C792Y

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	5.9e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197547

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Ttll7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ttll7	APN	3	146909582	missense	possibly damaging	0.72
IGL01353:Ttll7	APN	3	146961719	missense	probably damaging	1.00
IGL01415:Ttll7	APN	3	146909599	missense	possibly damaging	0.90
IGL01843:Ttll7	APN	3	146940021	missense	possibly damaging	0.93
IGL03101:Ttll7	APN	3	146896690	missense	possibly damaging	0.82
IGL03378:Ttll7	APN	3	146909653	missense	probably benign	0.06
P0038:Ttll7	UTSW	3	146945184	missense	possibly damaging	0.80
R0265:Ttll7	UTSW	3	146944160	nonsense	probably null
R0358:Ttll7	UTSW	3	146944116	missense	probably benign
R0363:Ttll7	UTSW	3	146944215	missense	probably benign	0.00
R0364:Ttll7	UTSW	3	146945181	missense	possibly damaging	0.82
R0751:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1184:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1533:Ttll7	UTSW	3	146896667	missense	probably damaging	1.00
R1771:Ttll7	UTSW	3	146894405	missense	probably benign	0.02
R1789:Ttll7	UTSW	3	146915780	missense	probably damaging	1.00
R1961:Ttll7	UTSW	3	146915795	splice site	probably benign
R2083:Ttll7	UTSW	3	146930104	missense	possibly damaging	0.77
R2152:Ttll7	UTSW	3	146930189	missense	probably damaging	1.00
R2655:Ttll7	UTSW	3	146947621	missense	probably damaging	1.00
R2926:Ttll7	UTSW	3	146930415	nonsense	probably null
R4888:Ttll7	UTSW	3	146894177	start codon destroyed	probably null	0.99
R4999:Ttll7	UTSW	3	146894469	missense	probably damaging	1.00
R5648:Ttll7	UTSW	3	146961710	missense	probably damaging	1.00
R5937:Ttll7	UTSW	3	146944092	nonsense	probably null
R6009:Ttll7	UTSW	3	146934535	missense	probably damaging	0.99
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6463:Ttll7	UTSW	3	146931582	missense	possibly damaging	0.86
R6747:Ttll7	UTSW	3	146944056	missense	probably benign	0.02
R6922:Ttll7	UTSW	3	146909614	missense	possibly damaging	0.92
R7123:Ttll7	UTSW	3	146913296	missense	possibly damaging	0.95
R7211:Ttll7	UTSW	3	146913276	missense	probably damaging	0.97
R8229:Ttll7	UTSW	3	146901449	missense	probably damaging	0.99
R8406:Ttll7	UTSW	3	146940024	missense	probably benign
RF015:Ttll7	UTSW	3	146979658	missense	probably benign	0.00
X0024:Ttll7	UTSW	3	146909553	missense	probably damaging	1.00
X0026:Ttll7	UTSW	3	146961695	missense	probably damaging	1.00
X0027:Ttll7	UTSW	3	146947653	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146915771	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146930178	missense	probably benign	0.01
Z1176:Ttll7	UTSW	3	146947635	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCACATGTGCATGCTGC -3'
(R):5'- TCGTCCAAATCAACTTAGTTGC -3'

Sequencing Primer
(F):5'- GGCAGGAGATGACACTTACCTTTC -3'
(R):5'- CCATTTCCATGGTCTAGCT -3'

Posted On

2014-08-25