Incidental Mutation 'R1995:Dmp1'
ID225673
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104209913 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 40 (S40A)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066708
AA Change: S40A

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: S40A

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R2004:Dmp1 UTSW 5 104211924 missense possibly damaging 0.73
R2009:Dmp1 UTSW 5 104212840 missense probably damaging 0.97
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R6389:Dmp1 UTSW 5 104212922 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
Z1177:Dmp1 UTSW 5 104211652 missense not run
Predicted Primers PCR Primer
(F):5'- CTGGATTCTGAGTCCCAGTG -3'
(R):5'- AATTACCTGTCCCTCTGGGC -3'

Sequencing Primer
(F):5'- CTGGATTCTGAGTCCCAGTGTTATC -3'
(R):5'- CTGATGACTCACTGTTCTGAAAGG -3'
Posted On2014-08-25