Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Zp2'

225680

Institutional Source

Beutler Lab

Gene Symbol

Zp2

Ensembl Gene

ENSMUSG00000030911

Gene Name

zona pellucida glycoprotein 2

Synonyms

Zp-2

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120126772-120145291 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120135165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 554 (I554F)

Ref Sequence

ENSEMBL: ENSMUSP00000147097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]

AlphaFold

P20239

Predicted Effect

probably damaging
Transcript: ENSMUST00000033207
AA Change: I554F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: I554F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
ZP	364	630	1.06e-86	SMART
low complexity region	655	668	N/A	INTRINSIC
transmembrane domain	684	703	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207333

Predicted Effect

probably benign
Transcript: ENSMUST00000207726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208122

Predicted Effect

probably damaging
Transcript: ENSMUST00000208874
AA Change: I554F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het

Other mutations in Zp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Zp2	APN	7	120133400	missense	probably benign	0.00
IGL00707:Zp2	APN	7	120133413	missense	probably benign	0.03
IGL00916:Zp2	APN	7	120138174	missense	probably damaging	1.00
IGL01554:Zp2	APN	7	120138325	missense	possibly damaging	0.78
IGL01845:Zp2	APN	7	120138191	missense	probably damaging	1.00
IGL02111:Zp2	APN	7	120132418	missense	possibly damaging	0.75
IGL02145:Zp2	APN	7	120139851	critical splice acceptor site	probably null
IGL02155:Zp2	APN	7	120144117	missense	probably benign	0.00
IGL02178:Zp2	APN	7	120133750	missense	possibly damaging	0.85
IGL02646:Zp2	APN	7	120135341	missense	possibly damaging	0.92
IGL03220:Zp2	APN	7	120137227	missense	possibly damaging	0.90
PIT4687001:Zp2	UTSW	7	120141879	missense	probably benign	0.00
R0138:Zp2	UTSW	7	120137200	missense	probably damaging	0.96
R0197:Zp2	UTSW	7	120143576	splice site	probably benign
R0519:Zp2	UTSW	7	120138149	missense	probably damaging	1.00
R0573:Zp2	UTSW	7	120135470	splice site	probably benign
R0879:Zp2	UTSW	7	120135534	missense	probably damaging	1.00
R0883:Zp2	UTSW	7	120143576	splice site	probably benign
R1160:Zp2	UTSW	7	120136045	missense	probably damaging	1.00
R1235:Zp2	UTSW	7	120138343	missense	possibly damaging	0.57
R1753:Zp2	UTSW	7	120138105	missense	probably benign
R1883:Zp2	UTSW	7	120133401	missense	probably benign	0.02
R2196:Zp2	UTSW	7	120138306	missense	probably benign
R2850:Zp2	UTSW	7	120138306	missense	probably benign
R3715:Zp2	UTSW	7	120141834	missense	possibly damaging	0.95
R3931:Zp2	UTSW	7	120132357	intron	probably benign
R4082:Zp2	UTSW	7	120135252	missense	probably benign	0.01
R4731:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4732:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4733:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4754:Zp2	UTSW	7	120138318	missense	probably benign	0.01
R4863:Zp2	UTSW	7	120135772	missense	probably damaging	1.00
R5274:Zp2	UTSW	7	120138092	missense	possibly damaging	0.92
R5392:Zp2	UTSW	7	120135764	nonsense	probably null
R5877:Zp2	UTSW	7	120133339	missense	probably null	0.94
R6390:Zp2	UTSW	7	120141230	missense	probably benign	0.23
R6404:Zp2	UTSW	7	120135542	missense	possibly damaging	0.73
R6546:Zp2	UTSW	7	120132525	missense	probably benign	0.00
R6622:Zp2	UTSW	7	120132525	missense	probably benign	0.00
R6622:Zp2	UTSW	7	120141913	missense	probably benign
R6707:Zp2	UTSW	7	120133922	missense	possibly damaging	0.85
R7274:Zp2	UTSW	7	120132391	makesense	probably null
R7275:Zp2	UTSW	7	120135353	splice site	probably null
R7541:Zp2	UTSW	7	120136056	missense	probably damaging	1.00
R7585:Zp2	UTSW	7	120133944	missense	probably damaging	1.00
R7709:Zp2	UTSW	7	120135775	missense	probably damaging	1.00
R7742:Zp2	UTSW	7	120132508	missense	unknown
R7767:Zp2	UTSW	7	120137169	missense	probably benign	0.01
R7771:Zp2	UTSW	7	120143642	missense	probably damaging	0.96
R8391:Zp2	UTSW	7	120126956	missense	probably benign	0.00
R8872:Zp2	UTSW	7	120133802	missense	probably benign	0.14
R8880:Zp2	UTSW	7	120143612	missense	possibly damaging	0.80
R9673:Zp2	UTSW	7	120134015	missense	probably damaging	1.00
X0017:Zp2	UTSW	7	120133385	missense	probably damaging	1.00
X0023:Zp2	UTSW	7	120133367	missense	probably damaging	1.00
Z1176:Zp2	UTSW	7	120135179	missense	not run
Z1177:Zp2	UTSW	7	120135179	missense	not run
Z1177:Zp2	UTSW	7	120135209	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCATTCCGTAAGAGTTCG -3'
(R):5'- TCCTGTTAATTGCAGACCAATCC -3'

Sequencing Primer
(F):5'- ACAAGCAGTGTGAGCTACCTAATTAG -3'
(R):5'- TCCTACCAACGGCCTTACAGG -3'

Posted On

2014-08-25