Incidental Mutation 'R1995:Dpysl4'
ID225682
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Namedihydropyrimidinase-like 4
SynonymsDrp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location139086001-139102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139096770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 379 (I379V)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000145499]
Predicted Effect probably benign
Transcript: ENSMUST00000026551
AA Change: I358V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: I358V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121184
AA Change: I379V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: I379V

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139364
Predicted Effect probably benign
Transcript: ENSMUST00000145499
SMART Domains Protein: ENSMUSP00000117764
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 148 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 139096176 missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 139096173 missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 139098600 missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 139096735 missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 139099910 splice site probably null
PIT4382001:Dpysl4 UTSW 7 139089578 nonsense probably null
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R1624:Dpysl4 UTSW 7 139089553 missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 139090338 missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 139090299 missense probably benign
R1885:Dpysl4 UTSW 7 139096807 missense probably damaging 1.00
R2698:Dpysl4 UTSW 7 139096765 missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 139096236 missense probably benign 0.01
R3762:Dpysl4 UTSW 7 139096756 missense probably damaging 1.00
R3851:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R3852:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 139098621 missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 139090290 missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 139091990 missense probably benign
R5608:Dpysl4 UTSW 7 139098543 missense probably damaging 0.97
R5762:Dpysl4 UTSW 7 139091937 missense probably benign
R5887:Dpysl4 UTSW 7 139096276 missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 139086084 unclassified probably benign
R6060:Dpysl4 UTSW 7 139089408 start codon destroyed probably null
R6180:Dpysl4 UTSW 7 139090334 missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 139099818 missense probably benign
R6809:Dpysl4 UTSW 7 139093660 missense probably benign 0.19
R6949:Dpysl4 UTSW 7 139091999 missense probably damaging 1.00
R7647:Dpysl4 UTSW 7 139099773 missense possibly damaging 0.92
R7695:Dpysl4 UTSW 7 139086123 start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 139089540 missense probably benign
R8129:Dpysl4 UTSW 7 139086160 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTCCATAGCCTTGGCTTG -3'
(R):5'- ACTAGGTGTCACTGCTAGGTG -3'

Sequencing Primer
(F):5'- TGCCTAGGAAGCTGGAGC -3'
(R):5'- TGCCGTCACTGCTAAGCTAAG -3'
Posted On2014-08-25