Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Olfr965'

225684

Institutional Source

Beutler Lab

Gene Symbol

Olfr965

Ensembl Gene

ENSMUSG00000095839

Gene Name

olfactory receptor 965

Synonyms

GA_x6K02T2PVTD-33416730-33417668, MOR171-28

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39711353-39720614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39719413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 62 (F62S)

Ref Sequence

ENSEMBL: ENSMUSP00000150401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]

AlphaFold

Q7TRA7

Predicted Effect

probably damaging
Transcript: ENSMUST00000069342
AA Change: F62S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: F62S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.4e-47	PFAM
Pfam:7tm_1	41	290	4.2e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213335
AA Change: F62S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214875

Predicted Effect

probably damaging
Transcript: ENSMUST00000215164
AA Change: F62S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Olfr965

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01705:Olfr965	APN	9	39719581	missense	possibly damaging	0.95
IGL02365:Olfr965	APN	9	39719674	missense	possibly damaging	0.60
IGL02365:Olfr965	APN	9	39720100	missense	probably damaging	0.98
IGL03062:Olfr965	APN	9	39720035	missense	probably benign	0.26
IGL03330:Olfr965	APN	9	39719488	missense	probably benign	0.08
R0011:Olfr965	UTSW	9	39719627	missense	probably benign	0.26
R0462:Olfr965	UTSW	9	39719410	missense	probably benign	0.01
R1505:Olfr965	UTSW	9	39719478	missense	probably damaging	1.00
R2049:Olfr965	UTSW	9	39720115	missense	probably damaging	1.00
R2110:Olfr965	UTSW	9	39719722	missense	probably benign	0.30
R3817:Olfr965	UTSW	9	39720108	missense	possibly damaging	0.95
R4152:Olfr965	UTSW	9	39720000	missense	probably benign	0.10
R4153:Olfr965	UTSW	9	39720000	missense	probably benign	0.10
R4351:Olfr965	UTSW	9	39719569	missense	probably damaging	0.99
R4377:Olfr965	UTSW	9	39719807	missense	probably benign	0.04
R4667:Olfr965	UTSW	9	39719709	missense	probably benign	0.09
R5526:Olfr965	UTSW	9	39719596	missense	possibly damaging	0.95
R5816:Olfr965	UTSW	9	39719230	start codon destroyed	probably null	1.00
R7113:Olfr965	UTSW	9	39719677	missense	probably benign
R7336:Olfr965	UTSW	9	39719610	missense	probably benign	0.28
R8153:Olfr965	UTSW	9	39719658	missense	possibly damaging	0.68
R8291:Olfr965	UTSW	9	39719545	missense	probably benign	0.00
R8779:Olfr965	UTSW	9	39719340	missense	probably damaging	0.99
R9617:Olfr965	UTSW	9	39719382	missense	possibly damaging	0.80
R9631:Olfr965	UTSW	9	39719865	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGAAGGCAATCAGTCCACAGTG -3'
(R):5'- TGGTGACATTATACCTCAAGGGG -3'

Sequencing Primer
(F):5'- AGTGACTGAGTTCATCCTCACAGG -3'
(R):5'- TTATACCTCAAGGGGTTACAGATGGC -3'

Posted On

2014-08-25