Incidental Mutation 'R1995:Tbcel'
ID 225685
Institutional Source Beutler Lab
Gene Symbol Tbcel
Ensembl Gene ENSMUSG00000037287
Gene Name tubulin folding cofactor E-like
Synonyms E130107N23Rik, Lrrc35
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 42323612-42383534 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 42362957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 29 (G29W)
Ref Sequence ENSEMBL: ENSMUSP00000116616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066148] [ENSMUST00000066179] [ENSMUST00000125995] [ENSMUST00000128959] [ENSMUST00000134374] [ENSMUST00000138506]
AlphaFold Q8C5W3
Predicted Effect probably damaging
Transcript: ENSMUST00000066148
AA Change: G29W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067882
Gene: ENSMUSG00000037287
AA Change: G29W

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066179
AA Change: G47W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065125
Gene: ENSMUSG00000037287
AA Change: G47W

DomainStartEndE-ValueType
internal_repeat_1 91 121 9.76e-6 PROSPERO
low complexity region 123 133 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
internal_repeat_1 191 221 9.76e-6 PROSPERO
Pfam:Ubiquitin_2 362 442 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125995
AA Change: G29W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114721
Gene: ENSMUSG00000037287
AA Change: G29W

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128959
AA Change: G29W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121164
Gene: ENSMUSG00000037287
AA Change: G29W

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134374
AA Change: G29W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000138506
AA Change: G29W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116616
Gene: ENSMUSG00000037287
AA Change: G29W

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,678,872 (GRCm39) K145N probably damaging Het
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Btbd9 A G 17: 30,493,904 (GRCm39) Y496H possibly damaging Het
Catsperb T A 12: 101,569,026 (GRCm39) N899K possibly damaging Het
Cenpl T C 1: 160,905,994 (GRCm39) S123P probably damaging Het
Cep120 G A 18: 53,873,208 (GRCm39) T41I probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 (GRCm39) P105S possibly damaging Het
Col6a1 T C 10: 76,557,790 (GRCm39) N149D probably damaging Het
Ctnna3 T A 10: 63,656,143 (GRCm39) V241D probably damaging Het
Dcbld2 A C 16: 58,276,695 (GRCm39) E495D probably benign Het
Dmp1 T G 5: 104,357,779 (GRCm39) S40A possibly damaging Het
Dpysl4 A G 7: 138,676,686 (GRCm39) I379V probably benign Het
Eral1 C T 11: 77,965,315 (GRCm39) G367S probably benign Het
Fah C T 7: 84,251,389 (GRCm39) R31Q probably damaging Het
Fbn1 T A 2: 125,192,293 (GRCm39) probably null Het
Fbxo40 T C 16: 36,790,231 (GRCm39) D293G probably damaging Het
Gemin6 A C 17: 80,535,414 (GRCm39) T125P probably damaging Het
Gpbar1 G A 1: 74,318,603 (GRCm39) G282D possibly damaging Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gucy1b1 A G 3: 81,942,160 (GRCm39) I533T probably damaging Het
H2-M9 A T 17: 36,952,678 (GRCm39) Y123N probably damaging Het
Hipk2 C A 6: 38,692,909 (GRCm39) D868Y probably damaging Het
Itprid1 T C 6: 55,945,694 (GRCm39) I805T probably benign Het
Jarid2 T C 13: 45,027,917 (GRCm39) L123P probably damaging Het
Kcnb2 C A 1: 15,779,990 (GRCm39) N287K possibly damaging Het
Kdm8 G A 7: 125,051,511 (GRCm39) G35S probably benign Het
Kirrel1 G T 3: 87,003,093 (GRCm39) A100D possibly damaging Het
Ltbp2 T G 12: 84,855,220 (GRCm39) probably null Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Neb C T 2: 52,188,744 (GRCm39) V837M probably damaging Het
Nkain2 A G 10: 32,278,347 (GRCm39) I26T possibly damaging Het
Nuggc A G 14: 65,848,623 (GRCm39) R175G probably benign Het
Or10ag57 T G 2: 87,218,175 (GRCm39) I42R probably damaging Het
Or5ac23 A G 16: 59,149,654 (GRCm39) S73P probably damaging Het
Or5d35 T A 2: 87,856,016 (GRCm39) S317T probably benign Het
Or8g52 T C 9: 39,630,709 (GRCm39) F62S probably damaging Het
Pcnt G A 10: 76,228,633 (GRCm39) Q1511* probably null Het
Piezo2 G T 18: 63,211,852 (GRCm39) T1311K probably damaging Het
Pik3c2a T C 7: 115,953,241 (GRCm39) Y1218C probably damaging Het
Pik3r4 T A 9: 105,546,364 (GRCm39) S905T probably benign Het
Pikfyve T A 1: 65,285,867 (GRCm39) D1035E probably damaging Het
Pkn3 G C 2: 29,979,989 (GRCm39) G744A probably damaging Het
Pms1 A G 1: 53,234,174 (GRCm39) S781P probably benign Het
Pogz C T 3: 94,785,255 (GRCm39) R793W probably damaging Het
Prrc2a A T 17: 35,376,405 (GRCm39) V795D probably damaging Het
Rock1 G A 18: 10,101,026 (GRCm39) R630* probably null Het
Scd4 T A 19: 44,322,617 (GRCm39) I70N possibly damaging Het
Serpine2 A G 1: 79,799,159 (GRCm39) S32P probably damaging Het
Slc9c1 A C 16: 45,374,618 (GRCm39) T328P probably damaging Het
Spata31d1b G C 13: 59,864,194 (GRCm39) L447F probably benign Het
Speer2 A G 16: 69,654,965 (GRCm39) S167P probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Tmem240 T A 4: 155,824,304 (GRCm39) D125E possibly damaging Het
Ttll7 G A 3: 146,667,510 (GRCm39) C792Y possibly damaging Het
Vmn1r177 T A 7: 23,565,112 (GRCm39) I255F probably damaging Het
Zp2 T A 7: 119,734,388 (GRCm39) I554F probably damaging Het
Other mutations in Tbcel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Tbcel APN 9 42,354,333 (GRCm39) missense probably benign 0.03
IGL01432:Tbcel APN 9 42,355,817 (GRCm39) missense possibly damaging 0.79
IGL02223:Tbcel APN 9 42,363,014 (GRCm39) missense probably benign 0.14
IGL03336:Tbcel APN 9 42,350,427 (GRCm39) missense probably benign 0.17
R0346:Tbcel UTSW 9 42,348,539 (GRCm39) splice site probably benign
R0415:Tbcel UTSW 9 42,355,796 (GRCm39) missense probably benign 0.43
R0849:Tbcel UTSW 9 42,348,453 (GRCm39) missense probably damaging 1.00
R1203:Tbcel UTSW 9 42,362,947 (GRCm39) missense probably damaging 1.00
R1370:Tbcel UTSW 9 42,361,358 (GRCm39) missense probably damaging 1.00
R1617:Tbcel UTSW 9 42,372,589 (GRCm39) intron probably benign
R3196:Tbcel UTSW 9 42,327,248 (GRCm39) missense probably damaging 0.99
R3618:Tbcel UTSW 9 42,372,591 (GRCm39) intron probably benign
R4681:Tbcel UTSW 9 42,361,268 (GRCm39) missense probably damaging 1.00
R5008:Tbcel UTSW 9 42,327,419 (GRCm39) missense probably damaging 1.00
R5497:Tbcel UTSW 9 42,363,041 (GRCm39) start codon destroyed possibly damaging 0.59
R5838:Tbcel UTSW 9 42,327,168 (GRCm39) missense probably damaging 0.98
R5976:Tbcel UTSW 9 42,350,499 (GRCm39) missense possibly damaging 0.95
R6993:Tbcel UTSW 9 42,327,413 (GRCm39) nonsense probably null
R8480:Tbcel UTSW 9 42,375,169 (GRCm39) splice site probably null
S24628:Tbcel UTSW 9 42,355,796 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CAGCCAATCTGGAAGACTCAG -3'
(R):5'- CAGCCTCCTTCCTTGTGAATAAG -3'

Sequencing Primer
(F):5'- ATCTGGAAGACTCAGTTCTCCGAG -3'
(R):5'- CTCCTTCCTTGTGAATAAGAATTCG -3'
Posted On 2014-08-25