Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Pik3r4'

225687

Institutional Source

Beutler Lab

Gene Symbol

Pik3r4

Ensembl Gene

ENSMUSG00000032571

Gene Name

phosphoinositide-3-kinase regulatory subunit 4

Synonyms

D9Ertd418e, 2210010O15Rik, C730038E05Rik

MMRRC Submission

040005-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1995 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

105642978-105687657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105669165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 905 (S905T)

Ref Sequence

ENSEMBL: ENSMUSP00000139427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000191268]

AlphaFold

Q8VD65

Predicted Effect

probably benign
Transcript: ENSMUST00000065778
AA Change: S905T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: S905T

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	1.7e-5	PFAM
Pfam:Pkinase	26	312	1.2e-18	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122710

Predicted Effect

probably benign
Transcript: ENSMUST00000186943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187573

Predicted Effect

probably benign
Transcript: ENSMUST00000191268
AA Change: S905T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: S905T

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	26	310	8.9e-7	PFAM
Pfam:Pkinase	26	312	3.7e-23	PFAM
coiled coil region	941	963	N/A	INTRINSIC
WD40	982	1021	3.99e-8	SMART
WD40	1031	1070	6.16e0	SMART
WD40	1132	1169	4.58e1	SMART
WD40	1171	1214	1.64e2	SMART
WD40	1228	1269	2.76e-2	SMART
WD40	1317	1358	2.96e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Pik3r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Pik3r4	APN	9	105644604	missense	possibly damaging	0.75
IGL01617:Pik3r4	APN	9	105654965	missense	probably benign	0.33
IGL01764:Pik3r4	APN	9	105685122	splice site	probably benign
IGL01817:Pik3r4	APN	9	105650822	missense	probably damaging	1.00
IGL01830:Pik3r4	APN	9	105644955	missense	probably damaging	1.00
IGL01905:Pik3r4	APN	9	105644878	nonsense	probably null
IGL01947:Pik3r4	APN	9	105686150	missense	possibly damaging	0.91
IGL01985:Pik3r4	APN	9	105663045	missense	probably benign	0.03
IGL02321:Pik3r4	APN	9	105644478	missense	probably benign	0.04
IGL02389:Pik3r4	APN	9	105650331	missense	possibly damaging	0.88
IGL02898:Pik3r4	APN	9	105650406	missense	probably benign	0.21
IGL03037:Pik3r4	APN	9	105650813	missense	probably damaging	1.00
boteh	UTSW	9	105667938	splice site	probably null
truth	UTSW	9	105650606	missense	probably damaging	0.98
verisimilitude	UTSW	9	105678153	missense	probably benign	0.17
IGL02835:Pik3r4	UTSW	9	105672706	missense	probably benign	0.07
R0011:Pik3r4	UTSW	9	105644637	missense	probably benign	0.01
R0312:Pik3r4	UTSW	9	105686210	missense	probably damaging	1.00
R0321:Pik3r4	UTSW	9	105648707	missense	probably damaging	1.00
R0482:Pik3r4	UTSW	9	105669045	missense	probably benign	0.04
R0645:Pik3r4	UTSW	9	105669187	splice site	probably benign
R0690:Pik3r4	UTSW	9	105653976	missense	possibly damaging	0.81
R0789:Pik3r4	UTSW	9	105685167	missense	probably benign	0.14
R0894:Pik3r4	UTSW	9	105667771	missense	possibly damaging	0.73
R0988:Pik3r4	UTSW	9	105687205	missense	probably damaging	0.97
R1123:Pik3r4	UTSW	9	105663129	missense	probably benign
R1172:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1174:Pik3r4	UTSW	9	105663174	missense	probably damaging	1.00
R1342:Pik3r4	UTSW	9	105650901	critical splice donor site	probably null
R1387:Pik3r4	UTSW	9	105644291	missense	probably damaging	1.00
R1480:Pik3r4	UTSW	9	105687244	missense	probably benign	0.39
R1638:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R1643:Pik3r4	UTSW	9	105687152	missense	possibly damaging	0.83
R2037:Pik3r4	UTSW	9	105650335	missense	probably benign	0.00
R2165:Pik3r4	UTSW	9	105672785	missense	probably benign	0.05
R4210:Pik3r4	UTSW	9	105650758	missense	possibly damaging	0.57
R4515:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4519:Pik3r4	UTSW	9	105672725	missense	probably damaging	1.00
R4630:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4632:Pik3r4	UTSW	9	105654899	missense	probably benign	0.06
R4732:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4733:Pik3r4	UTSW	9	105678176	missense	possibly damaging	0.56
R4940:Pik3r4	UTSW	9	105668994	missense	probably benign	0.20
R5120:Pik3r4	UTSW	9	105669009	missense	probably benign	0.30
R5169:Pik3r4	UTSW	9	105678161	missense	probably benign	0.14
R5183:Pik3r4	UTSW	9	105682308	missense	possibly damaging	0.87
R5353:Pik3r4	UTSW	9	105667938	splice site	probably null
R5463:Pik3r4	UTSW	9	105648731	missense	probably damaging	1.00
R5635:Pik3r4	UTSW	9	105667825	missense	probably benign	0.01
R5763:Pik3r4	UTSW	9	105669775	missense	probably benign	0.01
R5830:Pik3r4	UTSW	9	105644824	nonsense	probably null
R6251:Pik3r4	UTSW	9	105654048	missense	probably benign
R6468:Pik3r4	UTSW	9	105685190	missense	possibly damaging	0.86
R6611:Pik3r4	UTSW	9	105644277	missense	probably damaging	0.99
R6642:Pik3r4	UTSW	9	105644646	missense	probably benign	0.11
R6821:Pik3r4	UTSW	9	105650606	missense	probably damaging	0.98
R7039:Pik3r4	UTSW	9	105676890	missense	possibly damaging	0.76
R7144:Pik3r4	UTSW	9	105650584	missense	probably damaging	0.98
R7410:Pik3r4	UTSW	9	105650591	missense	probably damaging	0.99
R7559:Pik3r4	UTSW	9	105678153	missense	probably benign	0.17
R7561:Pik3r4	UTSW	9	105687247	missense	possibly damaging	0.94
R7658:Pik3r4	UTSW	9	105644511	missense	probably damaging	0.98
R7727:Pik3r4	UTSW	9	105669882	missense	probably damaging	0.99
R7871:Pik3r4	UTSW	9	105663117	missense	probably damaging	1.00
R7957:Pik3r4	UTSW	9	105687209	missense	probably damaging	1.00
R8138:Pik3r4	UTSW	9	105669035	missense	possibly damaging	0.55
R8686:Pik3r4	UTSW	9	105658529	missense	possibly damaging	0.50
R8719:Pik3r4	UTSW	9	105682195	missense	probably benign	0.00
R9091:Pik3r4	UTSW	9	105669909	missense	probably benign	0.35
R9189:Pik3r4	UTSW	9	105669839	missense	probably benign	0.22
R9270:Pik3r4	UTSW	9	105669909	missense	probably benign	0.35
R9439:Pik3r4	UTSW	9	105650842	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTAGGGTCCATCGTGTTCTG -3'
(R):5'- GGTGACCTTCTCCGTGCTTAAG -3'

Sequencing Primer
(F):5'- GGTCCATCGTGTTCTGTTATAAATAG -3'
(R):5'- CTCCGTGCTTAAGTAACTGGG -3'

Posted On

2014-08-25