Incidental Mutation 'R1995:Col6a1'
ID225691
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission 040005-MU
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1995 (G1)
Quality Score210
Status Not validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76721956 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 149 (N149D)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect probably damaging
Transcript: ENSMUST00000001147
AA Change: N149D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: N149D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218963
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7741:Col6a1 UTSW 10 76709909 missense unknown
R7774:Col6a1 UTSW 10 76709876 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGAGGATGCCAGTGCTC -3'
(R):5'- TGTAACCCCATGAGACCGGATAC -3'

Sequencing Primer
(F):5'- CCCTCCATCTGTGAGTTTGGTATAAG -3'
(R):5'- CCATGAGACCGGATACTTTATAATTG -3'
Posted On2014-08-25