Incidental Mutation 'R1995:Tmcc3'
ID 225693
Institutional Source Beutler Lab
Gene Symbol Tmcc3
Ensembl Gene ENSMUSG00000020023
Gene Name transmembrane and coiled coil domains 3
Synonyms
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 94311949-94590956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94578606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 57 (S57P)
Ref Sequence ENSEMBL: ENSMUSP00000119496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065060] [ENSMUST00000117460] [ENSMUST00000117929] [ENSMUST00000121471] [ENSMUST00000132743] [ENSMUST00000148823] [ENSMUST00000148910]
AlphaFold Q8R310
Predicted Effect possibly damaging
Transcript: ENSMUST00000065060
AA Change: S88P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063264
Gene: ENSMUSG00000020023
AA Change: S88P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 65 465 1.2e-160 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117460
AA Change: S57P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112669
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117929
AA Change: S57P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112401
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121471
AA Change: S57P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113122
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 32 435 1.6e-176 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132743
AA Change: S57P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119751
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 47 134 3.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146744
Predicted Effect possibly damaging
Transcript: ENSMUST00000148823
AA Change: S57P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119496
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 85 210 3.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148910
AA Change: S57P

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121456
Gene: ENSMUSG00000020023
AA Change: S57P

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 34 76 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Tmcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Tmcc3 APN 10 94582285 missense probably damaging 1.00
IGL01455:Tmcc3 APN 10 94586755 missense probably damaging 0.97
IGL02376:Tmcc3 APN 10 94578567 missense possibly damaging 0.85
IGL03073:Tmcc3 APN 10 94578951 missense probably benign 0.40
IGL03348:Tmcc3 APN 10 94579080 missense possibly damaging 0.95
R0131:Tmcc3 UTSW 10 94545575 splice site probably benign
R0360:Tmcc3 UTSW 10 94578545 missense probably benign
R0840:Tmcc3 UTSW 10 94578771 missense probably benign 0.05
R1994:Tmcc3 UTSW 10 94578606 missense possibly damaging 0.95
R2184:Tmcc3 UTSW 10 94582306 missense probably damaging 1.00
R2197:Tmcc3 UTSW 10 94578918 missense probably damaging 1.00
R2273:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R2274:Tmcc3 UTSW 10 94578915 missense probably damaging 0.97
R3763:Tmcc3 UTSW 10 94579317 missense probably benign 0.42
R4690:Tmcc3 UTSW 10 94545557 utr 5 prime probably benign
R4763:Tmcc3 UTSW 10 94579311 missense probably damaging 1.00
R4816:Tmcc3 UTSW 10 94578784 missense possibly damaging 0.89
R5385:Tmcc3 UTSW 10 94579153 missense probably damaging 1.00
R6177:Tmcc3 UTSW 10 94582387 missense probably damaging 0.97
R6636:Tmcc3 UTSW 10 94578424 missense probably benign 0.14
R6898:Tmcc3 UTSW 10 94551172 splice site probably null
R7128:Tmcc3 UTSW 10 94430634 start gained probably benign
R7313:Tmcc3 UTSW 10 94430572 start gained probably benign
R7320:Tmcc3 UTSW 10 94578495 missense possibly damaging 0.94
R7456:Tmcc3 UTSW 10 94582312 missense possibly damaging 0.79
R7874:Tmcc3 UTSW 10 94551027 critical splice donor site probably null
R7876:Tmcc3 UTSW 10 94578535 missense probably benign 0.03
R8098:Tmcc3 UTSW 10 94579216 missense probably benign 0.00
R8274:Tmcc3 UTSW 10 94586876 missense probably damaging 1.00
R8276:Tmcc3 UTSW 10 94582308 missense probably damaging 0.97
R8939:Tmcc3 UTSW 10 94545621 intron probably benign
R9418:Tmcc3 UTSW 10 94579225 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCTTGTCTTTCAGGTGGACC -3'
(R):5'- GATGTCCTTTGAGCTCCTGG -3'

Sequencing Primer
(F):5'- TGGACCGCCATGACATGAATAC -3'
(R):5'- GGTCACGCCATTCTGTTCG -3'
Posted On 2014-08-25