Incidental Mutation 'R1995:Catsperb'
ID225697
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Namecation channel sperm associated auxiliary subunit beta
Synonyms4932415G16Rik
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101404653-101626009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101602767 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 899 (N899K)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055156
AA Change: N899K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: N899K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221241
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1449:Catsperb UTSW 12 101588197 missense probably benign 0.09
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101446068 missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6165:Catsperb UTSW 12 101575816 missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101412568 intron probably null
R6297:Catsperb UTSW 12 101591396 unclassified probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101481048 missense probably damaging 1.00
R7422:Catsperb UTSW 12 101588034 missense probably damaging 1.00
R7425:Catsperb UTSW 12 101591498 missense probably damaging 0.96
R7578:Catsperb UTSW 12 101588285 missense probably benign 0.01
R8021:Catsperb UTSW 12 101588063 missense probably benign 0.22
R8060:Catsperb UTSW 12 101602766 missense probably damaging 0.98
RF006:Catsperb UTSW 12 101575979 critical splice donor site probably null
Z1177:Catsperb UTSW 12 101446048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATCACAGAGTCAGGTCTC -3'
(R):5'- TGTGTGCACATGAGTACATCTG -3'

Sequencing Primer
(F):5'- CTCTGAAATTACAGAAACTGAGTGG -3'
(R):5'- GTACTACTTCCTAGGGGTCAAGC -3'
Posted On2014-08-25