Mutagenetix > Incidental Mutations

Incidental Mutation 'R1995:Catsperb'

225697

Institutional Source

Beutler Lab

Gene Symbol

Catsperb

Ensembl Gene

ENSMUSG00000047014

Gene Name

cation channel sperm associated auxiliary subunit beta

Synonyms

4932415G16Rik

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101404653-101626009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101602767 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 899 (N899K)

Ref Sequence

ENSEMBL: ENSMUSP00000052089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055156
AA Change: N899K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: N899K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	73	95	N/A	INTRINSIC
Pfam:CATSPERB	569	1088	1.1e-258	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221241

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Catsperb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00532:Catsperb	APN	12	101463119	missense	probably damaging	1.00
IGL00580:Catsperb	APN	12	101591529	missense	probably benign	0.01
IGL00661:Catsperb	APN	12	101588098	missense	probably damaging	1.00
IGL00979:Catsperb	APN	12	101415325	missense	probably benign	0.34
IGL01154:Catsperb	APN	12	101625681	missense	possibly damaging	0.79
IGL01360:Catsperb	APN	12	101625254	missense	probably damaging	1.00
IGL01607:Catsperb	APN	12	101480726	splice site	probably benign
IGL01679:Catsperb	APN	12	101591582	splice site	probably null
IGL01827:Catsperb	APN	12	101591540	missense	probably benign	0.00
IGL01866:Catsperb	APN	12	101509311	nonsense	probably null
IGL02161:Catsperb	APN	12	101409415	splice site	probably benign
IGL02177:Catsperb	APN	12	101541462	missense	probably damaging	1.00
IGL02618:Catsperb	APN	12	101480724	splice site	probably benign
IGL02721:Catsperb	APN	12	101625297	missense	probably null	1.00
IGL02828:Catsperb	APN	12	101480782	missense	probably benign	0.00
R0571:Catsperb	UTSW	12	101602774	missense	possibly damaging	0.72
R0727:Catsperb	UTSW	12	101594355	splice site	probably null
R0842:Catsperb	UTSW	12	101463048	missense	probably damaging	1.00
R1187:Catsperb	UTSW	12	101625732	missense	probably benign	0.07
R1432:Catsperb	UTSW	12	101622217	missense	probably damaging	1.00
R1449:Catsperb	UTSW	12	101588197	missense	probably benign	0.09
R1488:Catsperb	UTSW	12	101594267	missense	probably damaging	0.97
R1540:Catsperb	UTSW	12	101412330	missense	probably benign	0.02
R1560:Catsperb	UTSW	12	101625726	missense	probably benign	0.01
R1563:Catsperb	UTSW	12	101588102	missense	probably damaging	1.00
R1583:Catsperb	UTSW	12	101463114	missense	probably damaging	0.96
R1989:Catsperb	UTSW	12	101602711	missense	probably damaging	1.00
R1993:Catsperb	UTSW	12	101602767	missense	possibly damaging	0.86
R2037:Catsperb	UTSW	12	101507962	missense	probably damaging	1.00
R2186:Catsperb	UTSW	12	101480782	missense	probably benign	0.00
R2217:Catsperb	UTSW	12	101594219	missense	probably damaging	0.99
R2391:Catsperb	UTSW	12	101624706	missense	probably damaging	1.00
R2679:Catsperb	UTSW	12	101463145	missense	probably damaging	1.00
R3848:Catsperb	UTSW	12	101509326	missense	probably damaging	0.98
R4023:Catsperb	UTSW	12	101602683	nonsense	probably null
R4507:Catsperb	UTSW	12	101480828	critical splice donor site	probably null
R4558:Catsperb	UTSW	12	101591540	missense	possibly damaging	0.94
R4649:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4651:Catsperb	UTSW	12	101541512	missense	probably benign	0.01
R4866:Catsperb	UTSW	12	101507949	missense	probably damaging	1.00
R4873:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4875:Catsperb	UTSW	12	101587985	missense	possibly damaging	0.90
R4897:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5002:Catsperb	UTSW	12	101520554	missense	probably benign
R5137:Catsperb	UTSW	12	101549811	missense	probably damaging	0.96
R5396:Catsperb	UTSW	12	101594284	missense	possibly damaging	0.90
R5450:Catsperb	UTSW	12	101446068	missense	possibly damaging	0.92
R5484:Catsperb	UTSW	12	101575916	missense	probably benign	0.38
R5846:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
R5905:Catsperb	UTSW	12	101602700	missense	possibly damaging	0.69
R5906:Catsperb	UTSW	12	101510462	missense	probably damaging	1.00
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6034:Catsperb	UTSW	12	101575832	missense	probably benign
R6149:Catsperb	UTSW	12	101549839	missense	probably damaging	1.00
R6165:Catsperb	UTSW	12	101575816	missense	possibly damaging	0.90
R6210:Catsperb	UTSW	12	101412568	intron	probably null
R6297:Catsperb	UTSW	12	101591396	unclassified	probably null
R6302:Catsperb	UTSW	12	101588143	missense	possibly damaging	0.95
R6681:Catsperb	UTSW	12	101624735	nonsense	probably null
R6698:Catsperb	UTSW	12	101509207	missense	probably damaging	1.00
R6869:Catsperb	UTSW	12	101480737	missense	probably benign	0.09
R6948:Catsperb	UTSW	12	101481068	missense	probably benign	0.00
R7035:Catsperb	UTSW	12	101415334	missense	probably damaging	1.00
R7073:Catsperb	UTSW	12	101509238	missense	probably benign	0.09
R7100:Catsperb	UTSW	12	101446038	missense	possibly damaging	0.83
R7338:Catsperb	UTSW	12	101480984	missense	probably benign	0.08
R7397:Catsperb	UTSW	12	101588023	missense	possibly damaging	0.84
R7413:Catsperb	UTSW	12	101481048	missense	probably damaging	1.00
R7422:Catsperb	UTSW	12	101588034	missense	probably damaging	1.00
R7425:Catsperb	UTSW	12	101591498	missense	probably damaging	0.96
R7578:Catsperb	UTSW	12	101588285	missense	probably benign	0.01
R8021:Catsperb	UTSW	12	101588063	missense	probably benign	0.22
R8060:Catsperb	UTSW	12	101602766	missense	probably damaging	0.98
RF006:Catsperb	UTSW	12	101575979	critical splice donor site	probably null
Z1177:Catsperb	UTSW	12	101446048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCATCACAGAGTCAGGTCTC -3'
(R):5'- TGTGTGCACATGAGTACATCTG -3'

Sequencing Primer
(F):5'- CTCTGAAATTACAGAAACTGAGTGG -3'
(R):5'- GTACTACTTCCTAGGGGTCAAGC -3'

Posted On

2014-08-25