Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Jarid2'

225698

Institutional Source

Beutler Lab

Gene Symbol

Jarid2

Ensembl Gene

ENSMUSG00000038518

Gene Name

jumonji, AT rich interactive domain 2

Synonyms

jumonji, Jmj

MMRRC Submission

040005-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44729474-44921643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44874441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 123 (L123P)

Ref Sequence

ENSEMBL: ENSMUSP00000134630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000172977] [ENSMUST00000173003] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]

AlphaFold

Q62315

Predicted Effect

probably damaging
Transcript: ENSMUST00000044608
AA Change: L161P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: L161P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172581

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172924

Predicted Effect

probably benign
Transcript: ENSMUST00000172977

SMART Domains

Protein: ENSMUSP00000134276
Gene: ENSMUSG00000038518

Domain	Start	End	E-Value	Type
Blast:JmjC	8	61	4e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173003

Predicted Effect

probably damaging
Transcript: ENSMUST00000173246
AA Change: L161P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: L161P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173367

SMART Domains

Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
low complexity region	126	146	N/A	INTRINSIC
low complexity region	195	214	N/A	INTRINSIC
JmjN	415	456	1.77e-20	SMART
PDB:2RQ5\|A	476	507	3e-14	PDB
Blast:ARID	477	507	2e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000173704
AA Change: L161P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: L161P

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1190	1e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173906
AA Change: L123P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: L123P

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	143	157	N/A	INTRINSIC
low complexity region	227	247	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC
JmjN	516	557	1.77e-20	SMART
ARID	578	669	4.96e-24	SMART
BRIGHT	582	674	1.7e-29	SMART
low complexity region	753	762	N/A	INTRINSIC
JmjC	844	1008	1.04e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174683

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Jarid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Jarid2	APN	13	44884835	missense	probably damaging	1.00
IGL02217:Jarid2	APN	13	44913201	missense	probably damaging	1.00
IGL02378:Jarid2	APN	13	44914325	missense	probably damaging	0.98
IGL02604:Jarid2	APN	13	44874401	missense	probably damaging	1.00
IGL02865:Jarid2	APN	13	44910560	missense	probably damaging	1.00
IGL02926:Jarid2	APN	13	44902929	missense	probably benign	0.03
R0057:Jarid2	UTSW	13	44884856	missense	probably damaging	0.96
R0426:Jarid2	UTSW	13	44840882	critical splice donor site	probably null
R0545:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R0562:Jarid2	UTSW	13	44902359	missense	probably damaging	0.99
R1192:Jarid2	UTSW	13	44906545	missense	probably damaging	1.00
R1241:Jarid2	UTSW	13	44884892	splice site	probably benign
R1254:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1552:Jarid2	UTSW	13	44911199	missense	probably damaging	1.00
R1728:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1729:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1730:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1739:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1783:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1785:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1844:Jarid2	UTSW	13	44902743	missense	possibly damaging	0.71
R1896:Jarid2	UTSW	13	44884882	critical splice donor site	probably null
R1965:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1966:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2120:Jarid2	UTSW	13	44906336	missense	probably benign	0.17
R2142:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2172:Jarid2	UTSW	13	44902539	missense	probably damaging	0.99
R2242:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2245:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3110:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3111:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3112:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3115:Jarid2	UTSW	13	44896466	missense	probably damaging	1.00
R3620:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3704:Jarid2	UTSW	13	44902355	missense	probably benign
R3802:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R3804:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R4126:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4127:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4128:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4153:Jarid2	UTSW	13	44910426	missense	probably damaging	1.00
R4844:Jarid2	UTSW	13	44913772	missense	probably damaging	0.96
R5044:Jarid2	UTSW	13	44906565	missense	probably damaging	1.00
R5329:Jarid2	UTSW	13	44906271	missense	possibly damaging	0.49
R5632:Jarid2	UTSW	13	44896290	missense	probably damaging	0.97
R5820:Jarid2	UTSW	13	44902301	missense	possibly damaging	0.96
R6267:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6296:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6479:Jarid2	UTSW	13	44848289	missense	probably benign	0.22
R6619:Jarid2	UTSW	13	44874396	missense	probably damaging	1.00
R6633:Jarid2	UTSW	13	44884877	missense	probably damaging	0.97
R6970:Jarid2	UTSW	13	44902985	missense	probably damaging	1.00
R7020:Jarid2	UTSW	13	44884824	missense	probably damaging	1.00
R7155:Jarid2	UTSW	13	44902462	missense	probably damaging	1.00
R7223:Jarid2	UTSW	13	44896322	missense	possibly damaging	0.89
R7265:Jarid2	UTSW	13	44902272	missense	probably benign	0.29
R8321:Jarid2	UTSW	13	44848386	missense	probably damaging	0.96
R8872:Jarid2	UTSW	13	44902508	missense	possibly damaging	0.88
R9064:Jarid2	UTSW	13	44840850	missense
R9065:Jarid2	UTSW	13	44840850	missense
R9067:Jarid2	UTSW	13	44840850	missense
R9153:Jarid2	UTSW	13	44911202	missense	probably damaging	1.00
R9163:Jarid2	UTSW	13	44911251	missense	possibly damaging	0.92
R9468:Jarid2	UTSW	13	44919830	missense	probably damaging	1.00
R9541:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93
R9558:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93
R9559:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93
R9762:Jarid2	UTSW	13	44914777	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TACTGCTGCATGAGGTCCTG -3'
(R):5'- CTCAGAAGGTGGAATAAGGCAAATCTC -3'

Sequencing Primer
(F):5'- GCATGAGGTCCTGTATTCTCCAG -3'
(R):5'- AGGCAAATCTCTATTTTGAATCCATC -3'

Posted On

2014-08-25