Incidental Mutation 'R1995:Agtpbp1'
ID 225699
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene Name ATP/GTP binding protein 1
Synonyms 2310001G17Rik, Ccp1, Nna1, 4930445M19Rik, 1700020N17Rik, 2900054O13Rik, 5730402G09Rik, atms
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.815) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 59597348-59705184 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 59678872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 145 (K145N)
Ref Sequence ENSEMBL: ENSMUSP00000132697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165370] [ENSMUST00000165477] [ENSMUST00000171606] [ENSMUST00000170555] [ENSMUST00000169745] [ENSMUST00000167593] [ENSMUST00000165598] [ENSMUST00000165851] [ENSMUST00000170378] [ENSMUST00000168821] [ENSMUST00000170520] [ENSMUST00000166585] [ENSMUST00000167096]
AlphaFold Q641K1
Predicted Effect probably damaging
Transcript: ENSMUST00000022040
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: K145N

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109830
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: K145N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: K76N
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: K76N

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164215
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: K145N

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165370
Predicted Effect probably damaging
Transcript: ENSMUST00000165477
AA Change: K145N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000171606
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: K145N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170555
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: K145N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169745
AA Change: K145N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000167593
Predicted Effect probably benign
Transcript: ENSMUST00000165598
Predicted Effect probably benign
Transcript: ENSMUST00000165851
Predicted Effect probably benign
Transcript: ENSMUST00000170378
Predicted Effect probably benign
Transcript: ENSMUST00000168821
Predicted Effect probably benign
Transcript: ENSMUST00000170520
Predicted Effect probably benign
Transcript: ENSMUST00000166585
Predicted Effect probably benign
Transcript: ENSMUST00000167096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Btbd9 A G 17: 30,493,904 (GRCm39) Y496H possibly damaging Het
Catsperb T A 12: 101,569,026 (GRCm39) N899K possibly damaging Het
Cenpl T C 1: 160,905,994 (GRCm39) S123P probably damaging Het
Cep120 G A 18: 53,873,208 (GRCm39) T41I probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 (GRCm39) P105S possibly damaging Het
Col6a1 T C 10: 76,557,790 (GRCm39) N149D probably damaging Het
Ctnna3 T A 10: 63,656,143 (GRCm39) V241D probably damaging Het
Dcbld2 A C 16: 58,276,695 (GRCm39) E495D probably benign Het
Dmp1 T G 5: 104,357,779 (GRCm39) S40A possibly damaging Het
Dpysl4 A G 7: 138,676,686 (GRCm39) I379V probably benign Het
Eral1 C T 11: 77,965,315 (GRCm39) G367S probably benign Het
Fah C T 7: 84,251,389 (GRCm39) R31Q probably damaging Het
Fbn1 T A 2: 125,192,293 (GRCm39) probably null Het
Fbxo40 T C 16: 36,790,231 (GRCm39) D293G probably damaging Het
Gemin6 A C 17: 80,535,414 (GRCm39) T125P probably damaging Het
Gpbar1 G A 1: 74,318,603 (GRCm39) G282D possibly damaging Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gucy1b1 A G 3: 81,942,160 (GRCm39) I533T probably damaging Het
H2-M9 A T 17: 36,952,678 (GRCm39) Y123N probably damaging Het
Hipk2 C A 6: 38,692,909 (GRCm39) D868Y probably damaging Het
Itprid1 T C 6: 55,945,694 (GRCm39) I805T probably benign Het
Jarid2 T C 13: 45,027,917 (GRCm39) L123P probably damaging Het
Kcnb2 C A 1: 15,779,990 (GRCm39) N287K possibly damaging Het
Kdm8 G A 7: 125,051,511 (GRCm39) G35S probably benign Het
Kirrel1 G T 3: 87,003,093 (GRCm39) A100D possibly damaging Het
Ltbp2 T G 12: 84,855,220 (GRCm39) probably null Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Neb C T 2: 52,188,744 (GRCm39) V837M probably damaging Het
Nkain2 A G 10: 32,278,347 (GRCm39) I26T possibly damaging Het
Nuggc A G 14: 65,848,623 (GRCm39) R175G probably benign Het
Or10ag57 T G 2: 87,218,175 (GRCm39) I42R probably damaging Het
Or5ac23 A G 16: 59,149,654 (GRCm39) S73P probably damaging Het
Or5d35 T A 2: 87,856,016 (GRCm39) S317T probably benign Het
Or8g52 T C 9: 39,630,709 (GRCm39) F62S probably damaging Het
Pcnt G A 10: 76,228,633 (GRCm39) Q1511* probably null Het
Piezo2 G T 18: 63,211,852 (GRCm39) T1311K probably damaging Het
Pik3c2a T C 7: 115,953,241 (GRCm39) Y1218C probably damaging Het
Pik3r4 T A 9: 105,546,364 (GRCm39) S905T probably benign Het
Pikfyve T A 1: 65,285,867 (GRCm39) D1035E probably damaging Het
Pkn3 G C 2: 29,979,989 (GRCm39) G744A probably damaging Het
Pms1 A G 1: 53,234,174 (GRCm39) S781P probably benign Het
Pogz C T 3: 94,785,255 (GRCm39) R793W probably damaging Het
Prrc2a A T 17: 35,376,405 (GRCm39) V795D probably damaging Het
Rock1 G A 18: 10,101,026 (GRCm39) R630* probably null Het
Scd4 T A 19: 44,322,617 (GRCm39) I70N possibly damaging Het
Serpine2 A G 1: 79,799,159 (GRCm39) S32P probably damaging Het
Slc9c1 A C 16: 45,374,618 (GRCm39) T328P probably damaging Het
Spata31d1b G C 13: 59,864,194 (GRCm39) L447F probably benign Het
Speer2 A G 16: 69,654,965 (GRCm39) S167P probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Tbcel C A 9: 42,362,957 (GRCm39) G29W probably damaging Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Tmem240 T A 4: 155,824,304 (GRCm39) D125E possibly damaging Het
Ttll7 G A 3: 146,667,510 (GRCm39) C792Y possibly damaging Het
Vmn1r177 T A 7: 23,565,112 (GRCm39) I255F probably damaging Het
Zp2 T A 7: 119,734,388 (GRCm39) I554F probably damaging Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59,597,986 (GRCm39) missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59,609,908 (GRCm39) missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59,652,040 (GRCm39) missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59,655,877 (GRCm39) splice site probably benign
IGL01921:Agtpbp1 APN 13 59,660,297 (GRCm39) missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59,648,275 (GRCm39) missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59,648,303 (GRCm39) missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59,676,233 (GRCm39) missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59,630,415 (GRCm39) missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59,622,403 (GRCm39) missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59,679,894 (GRCm39) splice site probably benign
IGL03218:Agtpbp1 APN 13 59,648,021 (GRCm39) missense possibly damaging 0.94
bobs UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
drunk UTSW 13 59,660,136 (GRCm39) critical splice donor site probably benign
gru UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
rio UTSW 13 59,673,055 (GRCm39) critical splice acceptor site probably benign
shreds UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
Unfocused UTSW 13 59,609,884 (GRCm39) nonsense probably null
wobble UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59,609,845 (GRCm39) missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R0559:Agtpbp1 UTSW 13 59,644,814 (GRCm39) missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59,681,753 (GRCm39) intron probably benign
R0943:Agtpbp1 UTSW 13 59,648,416 (GRCm39) missense probably benign
R1196:Agtpbp1 UTSW 13 59,598,132 (GRCm39) unclassified probably benign
R1421:Agtpbp1 UTSW 13 59,643,389 (GRCm39) missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59,648,448 (GRCm39) splice site probably null
R1833:Agtpbp1 UTSW 13 59,613,797 (GRCm39) critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59,598,016 (GRCm39) missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59,678,872 (GRCm39) missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59,623,617 (GRCm39) frame shift probably null
R2006:Agtpbp1 UTSW 13 59,648,135 (GRCm39) missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59,622,383 (GRCm39) missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59,644,829 (GRCm39) missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59,608,410 (GRCm39) missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59,648,221 (GRCm39) missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59,676,213 (GRCm39) missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59,647,886 (GRCm39) missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59,648,386 (GRCm39) missense probably benign
R4969:Agtpbp1 UTSW 13 59,648,392 (GRCm39) missense probably benign
R5066:Agtpbp1 UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59,648,027 (GRCm39) missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59,648,453 (GRCm39) missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59,621,557 (GRCm39) missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59,630,394 (GRCm39) missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59,648,329 (GRCm39) missense probably benign
R5824:Agtpbp1 UTSW 13 59,613,913 (GRCm39) missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59,681,860 (GRCm39) nonsense probably null
R6109:Agtpbp1 UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59,598,114 (GRCm39) missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59,647,834 (GRCm39) missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59,624,854 (GRCm39) missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59,692,167 (GRCm39) splice site probably null
R6950:Agtpbp1 UTSW 13 59,598,080 (GRCm39) missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59,652,108 (GRCm39) missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59,613,852 (GRCm39) missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59,680,994 (GRCm39) missense possibly damaging 0.83
R7535:Agtpbp1 UTSW 13 59,652,067 (GRCm39) missense probably benign
R7683:Agtpbp1 UTSW 13 59,660,312 (GRCm39) missense probably damaging 1.00
R7713:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R8081:Agtpbp1 UTSW 13 59,676,221 (GRCm39) nonsense probably null
R8210:Agtpbp1 UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
R8861:Agtpbp1 UTSW 13 59,643,287 (GRCm39) missense probably damaging 1.00
R9163:Agtpbp1 UTSW 13 59,609,884 (GRCm39) nonsense probably null
R9199:Agtpbp1 UTSW 13 59,613,808 (GRCm39) missense probably benign 0.00
R9389:Agtpbp1 UTSW 13 59,613,884 (GRCm39) missense probably damaging 1.00
R9414:Agtpbp1 UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
R9435:Agtpbp1 UTSW 13 59,622,429 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CACACAGATGCTGCCACTTC -3'
(R):5'- CGTGAAGATAGGCTGTTTGC -3'

Sequencing Primer
(F):5'- AGATGCTGCCACTTCCCCAC -3'
(R):5'- AGGCTGTTTGCTGTATTTTAAAAAC -3'
Posted On 2014-08-25