Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Agtpbp1'

225699

Institutional Source

Beutler Lab

Gene Symbol

Agtpbp1

Ensembl Gene

ENSMUSG00000021557

Gene Name

ATP/GTP binding protein 1

Synonyms

2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik

MMRRC Submission

040005-MU

Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene?

Probably essential (E-score: 0.792) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59445742-59585227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 59531058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 145 (K145N)

Ref Sequence

ENSEMBL: ENSMUSP00000132697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165370] [ENSMUST00000165477] [ENSMUST00000165598] [ENSMUST00000165851] [ENSMUST00000166585] [ENSMUST00000167096] [ENSMUST00000167593] [ENSMUST00000171606] [ENSMUST00000170555] [ENSMUST00000169745] [ENSMUST00000170378] [ENSMUST00000168821] [ENSMUST00000170520]

AlphaFold

Q641K1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022040
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: K145N

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109830
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: K145N

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.3e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163149
AA Change: K76N

SMART Domains

Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: K76N

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164215
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: K145N

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165370

Predicted Effect

probably damaging
Transcript: ENSMUST00000165477
AA Change: K145N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000165598

Predicted Effect

probably benign
Transcript: ENSMUST00000165851

Predicted Effect

probably benign
Transcript: ENSMUST00000166585

Predicted Effect

probably benign
Transcript: ENSMUST00000167096

Predicted Effect

probably benign
Transcript: ENSMUST00000167593

Predicted Effect

probably damaging
Transcript: ENSMUST00000171606
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: K145N

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.3e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170555
AA Change: K145N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: K145N

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169745
AA Change: K145N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000170378

Predicted Effect

probably benign
Transcript: ENSMUST00000168821

Predicted Effect

probably benign
Transcript: ENSMUST00000170520

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,611,174	R175G	probably benign	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Agtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Agtpbp1	APN	13	59450172	missense	probably damaging	1.00
IGL00808:Agtpbp1	APN	13	59462094	missense	possibly damaging	0.84
IGL01298:Agtpbp1	APN	13	59504226	missense	possibly damaging	0.77
IGL01628:Agtpbp1	APN	13	59508063	splice site	probably benign
IGL01921:Agtpbp1	APN	13	59512483	missense	possibly damaging	0.71
IGL02189:Agtpbp1	APN	13	59500461	missense	probably benign	0.01
IGL02325:Agtpbp1	APN	13	59500489	missense	probably benign	0.01
IGL02700:Agtpbp1	APN	13	59528419	missense	probably damaging	1.00
IGL02821:Agtpbp1	APN	13	59482601	missense	possibly damaging	0.69
IGL03130:Agtpbp1	APN	13	59474589	missense	possibly damaging	0.73
IGL03167:Agtpbp1	APN	13	59532080	splice site	probably benign
IGL03218:Agtpbp1	APN	13	59500207	missense	possibly damaging	0.94
bobs	UTSW	13	59482571	missense	possibly damaging	0.53
drunk	UTSW	13	59512323	critical splice donor site	probably benign
gru	UTSW	13	59473746	missense	probably damaging	1.00
rio	UTSW	13	59525241	critical splice acceptor site	probably benign
shreds	UTSW	13	59462088	missense	probably damaging	1.00
Unfocused	UTSW	13	59462070	nonsense	probably null
wobble	UTSW	13	59474550	missense	probably damaging	1.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0276:Agtpbp1	UTSW	13	59462031	missense	possibly damaging	0.93
R0413:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R0559:Agtpbp1	UTSW	13	59497000	missense	probably benign	0.32
R0848:Agtpbp1	UTSW	13	59533939	intron	probably benign
R0943:Agtpbp1	UTSW	13	59500602	missense	probably benign
R1196:Agtpbp1	UTSW	13	59450318	unclassified	probably benign
R1421:Agtpbp1	UTSW	13	59495575	missense	possibly damaging	0.86
R1531:Agtpbp1	UTSW	13	59500634	splice site	probably null
R1833:Agtpbp1	UTSW	13	59465983	critical splice donor site	probably null
R1864:Agtpbp1	UTSW	13	59450202	missense	possibly damaging	0.92
R1994:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R2001:Agtpbp1	UTSW	13	59475803	frame shift	probably null
R2006:Agtpbp1	UTSW	13	59500321	missense	probably benign	0.00
R2397:Agtpbp1	UTSW	13	59474569	missense	probably benign	0.10
R2918:Agtpbp1	UTSW	13	59497015	missense	possibly damaging	0.90
R3873:Agtpbp1	UTSW	13	59460596	missense	possibly damaging	0.88
R3924:Agtpbp1	UTSW	13	59500407	missense	probably benign	0.01
R4649:Agtpbp1	UTSW	13	59528399	missense	possibly damaging	0.89
R4913:Agtpbp1	UTSW	13	59500072	missense	probably damaging	1.00
R4933:Agtpbp1	UTSW	13	59500572	missense	probably benign
R4969:Agtpbp1	UTSW	13	59500578	missense	probably benign
R5066:Agtpbp1	UTSW	13	59474550	missense	probably damaging	1.00
R5139:Agtpbp1	UTSW	13	59500213	missense	probably damaging	0.99
R5194:Agtpbp1	UTSW	13	59500639	missense	probably benign	0.19
R5269:Agtpbp1	UTSW	13	59473743	missense	probably damaging	1.00
R5352:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R5558:Agtpbp1	UTSW	13	59482580	missense	probably benign	0.05
R5687:Agtpbp1	UTSW	13	59500515	missense	probably benign
R5824:Agtpbp1	UTSW	13	59466099	missense	probably damaging	1.00
R5979:Agtpbp1	UTSW	13	59534046	nonsense	probably null
R6109:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R6264:Agtpbp1	UTSW	13	59450300	missense	possibly damaging	0.89
R6413:Agtpbp1	UTSW	13	59500020	missense	possibly damaging	0.90
R6498:Agtpbp1	UTSW	13	59477040	missense	possibly damaging	0.71
R6747:Agtpbp1	UTSW	13	59544353	splice site	probably null
R6950:Agtpbp1	UTSW	13	59450266	missense	probably benign	0.32
R7030:Agtpbp1	UTSW	13	59504294	missense	probably damaging	1.00
R7180:Agtpbp1	UTSW	13	59466038	missense	probably benign	0.11
R7196:Agtpbp1	UTSW	13	59533180	missense	possibly damaging	0.83
R7535:Agtpbp1	UTSW	13	59504253	missense	probably benign
R7683:Agtpbp1	UTSW	13	59512498	missense	probably damaging	1.00
R7713:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R8081:Agtpbp1	UTSW	13	59528407	nonsense	probably null
R8210:Agtpbp1	UTSW	13	59482571	missense	possibly damaging	0.53
R8861:Agtpbp1	UTSW	13	59495473	missense	probably damaging	1.00
R9163:Agtpbp1	UTSW	13	59462070	nonsense	probably null
R9199:Agtpbp1	UTSW	13	59465994	missense	probably benign	0.00
R9389:Agtpbp1	UTSW	13	59466070	missense	probably damaging	1.00
R9414:Agtpbp1	UTSW	13	59462088	missense	probably damaging	1.00
R9435:Agtpbp1	UTSW	13	59474615	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CACACAGATGCTGCCACTTC -3'
(R):5'- CGTGAAGATAGGCTGTTTGC -3'

Sequencing Primer
(F):5'- AGATGCTGCCACTTCCCCAC -3'
(R):5'- AGGCTGTTTGCTGTATTTTAAAAAC -3'

Posted On

2014-08-25