Incidental Mutation 'R1995:Spata31d1b'
ID 225700
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Name spermatogenesis associated 31 subfamily D, member 1B
Synonyms Gm4934, Fam75d1b
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 59860098-59867103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 59864194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 447 (L447F)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
AlphaFold E9QA57
Predicted Effect probably benign
Transcript: ENSMUST00000165133
AA Change: L447F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: L447F

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,678,872 (GRCm39) K145N probably damaging Het
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Btbd9 A G 17: 30,493,904 (GRCm39) Y496H possibly damaging Het
Catsperb T A 12: 101,569,026 (GRCm39) N899K possibly damaging Het
Cenpl T C 1: 160,905,994 (GRCm39) S123P probably damaging Het
Cep120 G A 18: 53,873,208 (GRCm39) T41I probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 (GRCm39) P105S possibly damaging Het
Col6a1 T C 10: 76,557,790 (GRCm39) N149D probably damaging Het
Ctnna3 T A 10: 63,656,143 (GRCm39) V241D probably damaging Het
Dcbld2 A C 16: 58,276,695 (GRCm39) E495D probably benign Het
Dmp1 T G 5: 104,357,779 (GRCm39) S40A possibly damaging Het
Dpysl4 A G 7: 138,676,686 (GRCm39) I379V probably benign Het
Eral1 C T 11: 77,965,315 (GRCm39) G367S probably benign Het
Fah C T 7: 84,251,389 (GRCm39) R31Q probably damaging Het
Fbn1 T A 2: 125,192,293 (GRCm39) probably null Het
Fbxo40 T C 16: 36,790,231 (GRCm39) D293G probably damaging Het
Gemin6 A C 17: 80,535,414 (GRCm39) T125P probably damaging Het
Gpbar1 G A 1: 74,318,603 (GRCm39) G282D possibly damaging Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gucy1b1 A G 3: 81,942,160 (GRCm39) I533T probably damaging Het
H2-M9 A T 17: 36,952,678 (GRCm39) Y123N probably damaging Het
Hipk2 C A 6: 38,692,909 (GRCm39) D868Y probably damaging Het
Itprid1 T C 6: 55,945,694 (GRCm39) I805T probably benign Het
Jarid2 T C 13: 45,027,917 (GRCm39) L123P probably damaging Het
Kcnb2 C A 1: 15,779,990 (GRCm39) N287K possibly damaging Het
Kdm8 G A 7: 125,051,511 (GRCm39) G35S probably benign Het
Kirrel1 G T 3: 87,003,093 (GRCm39) A100D possibly damaging Het
Ltbp2 T G 12: 84,855,220 (GRCm39) probably null Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Neb C T 2: 52,188,744 (GRCm39) V837M probably damaging Het
Nkain2 A G 10: 32,278,347 (GRCm39) I26T possibly damaging Het
Nuggc A G 14: 65,848,623 (GRCm39) R175G probably benign Het
Or10ag57 T G 2: 87,218,175 (GRCm39) I42R probably damaging Het
Or5ac23 A G 16: 59,149,654 (GRCm39) S73P probably damaging Het
Or5d35 T A 2: 87,856,016 (GRCm39) S317T probably benign Het
Or8g52 T C 9: 39,630,709 (GRCm39) F62S probably damaging Het
Pcnt G A 10: 76,228,633 (GRCm39) Q1511* probably null Het
Piezo2 G T 18: 63,211,852 (GRCm39) T1311K probably damaging Het
Pik3c2a T C 7: 115,953,241 (GRCm39) Y1218C probably damaging Het
Pik3r4 T A 9: 105,546,364 (GRCm39) S905T probably benign Het
Pikfyve T A 1: 65,285,867 (GRCm39) D1035E probably damaging Het
Pkn3 G C 2: 29,979,989 (GRCm39) G744A probably damaging Het
Pms1 A G 1: 53,234,174 (GRCm39) S781P probably benign Het
Pogz C T 3: 94,785,255 (GRCm39) R793W probably damaging Het
Prrc2a A T 17: 35,376,405 (GRCm39) V795D probably damaging Het
Rock1 G A 18: 10,101,026 (GRCm39) R630* probably null Het
Scd4 T A 19: 44,322,617 (GRCm39) I70N possibly damaging Het
Serpine2 A G 1: 79,799,159 (GRCm39) S32P probably damaging Het
Slc9c1 A C 16: 45,374,618 (GRCm39) T328P probably damaging Het
Speer2 A G 16: 69,654,965 (GRCm39) S167P probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Tbcel C A 9: 42,362,957 (GRCm39) G29W probably damaging Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Tmem240 T A 4: 155,824,304 (GRCm39) D125E possibly damaging Het
Ttll7 G A 3: 146,667,510 (GRCm39) C792Y possibly damaging Het
Vmn1r177 T A 7: 23,565,112 (GRCm39) I255F probably damaging Het
Zp2 T A 7: 119,734,388 (GRCm39) I554F probably damaging Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59,860,280 (GRCm39) missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59,865,854 (GRCm39) missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59,866,941 (GRCm39) utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59,863,883 (GRCm39) missense probably benign
R0071:Spata31d1b UTSW 13 59,863,163 (GRCm39) missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59,863,163 (GRCm39) missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59,864,091 (GRCm39) missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59,865,618 (GRCm39) missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59,865,332 (GRCm39) missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59,864,468 (GRCm39) missense probably benign
R1338:Spata31d1b UTSW 13 59,865,975 (GRCm39) frame shift probably null
R1539:Spata31d1b UTSW 13 59,863,733 (GRCm39) missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59,864,442 (GRCm39) missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59,863,274 (GRCm39) missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59,864,381 (GRCm39) missense probably benign
R1793:Spata31d1b UTSW 13 59,863,779 (GRCm39) missense probably benign
R1838:Spata31d1b UTSW 13 59,865,279 (GRCm39) missense probably benign 0.00
R1838:Spata31d1b UTSW 13 59,863,671 (GRCm39) missense probably benign
R1861:Spata31d1b UTSW 13 59,865,150 (GRCm39) missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59,865,882 (GRCm39) missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59,865,835 (GRCm39) missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59,864,194 (GRCm39) missense probably benign
R2407:Spata31d1b UTSW 13 59,864,660 (GRCm39) missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59,865,705 (GRCm39) missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59,864,675 (GRCm39) missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59,866,172 (GRCm39) missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59,864,426 (GRCm39) missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59,866,172 (GRCm39) missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59,863,535 (GRCm39) missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59,863,535 (GRCm39) missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59,866,169 (GRCm39) missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59,864,917 (GRCm39) missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59,864,097 (GRCm39) missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59,863,838 (GRCm39) missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59,864,309 (GRCm39) missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59,866,032 (GRCm39) missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59,866,866 (GRCm39) missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59,864,486 (GRCm39) missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59,866,787 (GRCm39) missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59,863,464 (GRCm39) missense probably benign
R6433:Spata31d1b UTSW 13 59,864,999 (GRCm39) missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59,865,269 (GRCm39) missense probably benign
R6980:Spata31d1b UTSW 13 59,863,236 (GRCm39) missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59,860,249 (GRCm39) missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59,863,955 (GRCm39) missense probably benign
R7147:Spata31d1b UTSW 13 59,866,028 (GRCm39) missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59,865,446 (GRCm39) missense probably benign
R7359:Spata31d1b UTSW 13 59,860,304 (GRCm39) missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59,864,723 (GRCm39) missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59,863,278 (GRCm39) missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59,864,726 (GRCm39) missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59,864,468 (GRCm39) missense probably benign
R7586:Spata31d1b UTSW 13 59,866,194 (GRCm39) missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59,863,577 (GRCm39) missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59,865,047 (GRCm39) missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59,865,047 (GRCm39) missense possibly damaging 0.65
R7989:Spata31d1b UTSW 13 59,866,182 (GRCm39) missense possibly damaging 0.94
R8078:Spata31d1b UTSW 13 59,863,263 (GRCm39) missense probably damaging 0.99
R8176:Spata31d1b UTSW 13 59,865,117 (GRCm39) missense probably benign
R8530:Spata31d1b UTSW 13 59,864,964 (GRCm39) missense unknown
R8776:Spata31d1b UTSW 13 59,863,283 (GRCm39) missense probably benign 0.00
R8776-TAIL:Spata31d1b UTSW 13 59,863,283 (GRCm39) missense probably benign 0.00
R9385:Spata31d1b UTSW 13 59,863,403 (GRCm39) missense probably damaging 0.99
R9476:Spata31d1b UTSW 13 59,863,467 (GRCm39) missense probably benign 0.08
R9522:Spata31d1b UTSW 13 59,864,780 (GRCm39) missense probably benign 0.00
R9786:Spata31d1b UTSW 13 59,866,155 (GRCm39) missense possibly damaging 0.56
R9789:Spata31d1b UTSW 13 59,860,196 (GRCm39) missense probably benign 0.03
Z1177:Spata31d1b UTSW 13 59,866,674 (GRCm39) missense probably benign 0.17
Z1177:Spata31d1b UTSW 13 59,863,265 (GRCm39) missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59,860,223 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCGTCAAGCAGCAAAGGC -3'
(R):5'- TGTGAAAATGCACCCCACAG -3'

Sequencing Primer
(F):5'- GCAAAGGCAAGCTCACGC -3'
(R):5'- ACAGTCTCGAGGCTCGGATTG -3'
Posted On 2014-08-25