Incidental Mutation 'R1995:Spata31d1b'
ID 225700
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Name spermatogenesis associated 31 subfamily D, member 1B
Synonyms Fam75d1b, Gm4934
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 59712284-59719295 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 59716380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 447 (L447F)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
AlphaFold E9QA57
Predicted Effect probably benign
Transcript: ENSMUST00000165133
AA Change: L447F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: L447F

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
H2-M9 A T 17: 36,641,786 Y123N probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59717804 missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59716628 missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6433:Spata31d1b UTSW 13 59717185 missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7147:Spata31d1b UTSW 13 59718214 missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59716909 missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59715464 missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59716912 missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59716654 missense probably benign
R7586:Spata31d1b UTSW 13 59718380 missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59715763 missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R7989:Spata31d1b UTSW 13 59718368 missense possibly damaging 0.94
R8078:Spata31d1b UTSW 13 59715449 missense probably damaging 0.99
R8176:Spata31d1b UTSW 13 59717303 missense probably benign
R8530:Spata31d1b UTSW 13 59717150 missense unknown
R8776:Spata31d1b UTSW 13 59715469 missense probably benign 0.00
R8776-TAIL:Spata31d1b UTSW 13 59715469 missense probably benign 0.00
R9385:Spata31d1b UTSW 13 59715589 missense probably damaging 0.99
R9476:Spata31d1b UTSW 13 59715653 missense probably benign 0.08
R9522:Spata31d1b UTSW 13 59716966 missense probably benign 0.00
R9786:Spata31d1b UTSW 13 59718341 missense possibly damaging 0.56
R9789:Spata31d1b UTSW 13 59712382 missense probably benign 0.03
Z1177:Spata31d1b UTSW 13 59712409 missense probably damaging 1.00
Z1177:Spata31d1b UTSW 13 59715451 missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59718860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CATTCGTCAAGCAGCAAAGGC -3'
(R):5'- TGTGAAAATGCACCCCACAG -3'

Sequencing Primer
(F):5'- GCAAAGGCAAGCTCACGC -3'
(R):5'- ACAGTCTCGAGGCTCGGATTG -3'
Posted On 2014-08-25