Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Nuggc'

225703

Institutional Source

Beutler Lab

Gene Symbol

Nuggc

Ensembl Gene

ENSMUSG00000061356

Gene Name

nuclear GTPase, germinal center associated

Synonyms

Gm600, SLIP-GC, LOC239151

MMRRC Submission

040005-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65598546-65648531 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65611174 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 175 (R175G)

Ref Sequence

ENSEMBL: ENSMUSP00000118402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]

AlphaFold

D3YWJ0

Predicted Effect

probably benign
Transcript: ENSMUST00000079469
AA Change: R191G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: R191G

Domain	Start	End	E-Value	Type
Pfam:Dynamin_N	119	372	2.2e-15	PFAM
low complexity region	406	421	N/A	INTRINSIC
Blast:AAA	434	739	4e-14	BLAST
coiled coil region	758	792	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150897
AA Change: R175G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: R175G

Domain	Start	End	E-Value	Type
Pfam:Dynamin_N	103	356	6.1e-16	PFAM
low complexity region	390	405	N/A	INTRINSIC
Blast:AAA	418	723	4e-14	BLAST
coiled coil region	742	776	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,531,058	K145N	probably damaging	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Btbd9	A	G	17: 30,274,930	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc129	T	C	6: 55,968,709	I805T	probably benign	Het
Cenpl	T	C	1: 161,078,424	S123P	probably damaging	Het
Cep120	G	A	18: 53,740,136	T41I	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,721,956	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,820,364	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,456,332	E495D	probably benign	Het
Dmp1	T	G	5: 104,209,913	S40A	possibly damaging	Het
Dpysl4	A	G	7: 139,096,770	I379V	probably benign	Het
Eral1	C	T	11: 78,074,489	G367S	probably benign	Het
Fah	C	T	7: 84,602,181	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,350,373		probably null	Het
Fbxo40	T	C	16: 36,969,869	D293G	probably damaging	Het
Gemin6	A	C	17: 80,227,985	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Gucy1b1	A	G	3: 82,034,853	I533T	probably damaging	Het
H2-M9	A	T	17: 36,641,786	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,715,974	D868Y	probably damaging	Het
Jarid2	T	C	13: 44,874,441	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,709,766	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,452,339	G35S	probably benign	Het
Kirrel	G	T	3: 87,095,786	A100D	possibly damaging	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mfsd12	C	A	10: 81,357,681	H28Q	probably damaging	Het
Neb	C	T	2: 52,298,732	V837M	probably damaging	Het
Nkain2	A	G	10: 32,402,351	I26T	possibly damaging	Het
Olfr1122	T	G	2: 87,387,831	I42R	probably damaging	Het
Olfr1161	T	A	2: 88,025,672	S317T	probably benign	Het
Olfr205	A	G	16: 59,329,291	S73P	probably damaging	Het
Olfr965	T	C	9: 39,719,413	F62S	probably damaging	Het
Pcnt	G	A	10: 76,392,799	Q1511*	probably null	Het
Piezo2	G	T	18: 63,078,781	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 116,354,006	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,669,165	S905T	probably benign	Het
Pikfyve	T	A	1: 65,246,708	D1035E	probably damaging	Het
Pkn3	G	C	2: 30,089,977	G744A	probably damaging	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Pogz	C	T	3: 94,877,944	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,157,429	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026	R630*	probably null	Het
Scd4	T	A	19: 44,334,178	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,554,255	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,716,380	L447F	probably benign	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Tbcel	C	A	9: 42,451,661	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,578,606	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,739,847	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,961,755	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,865,687	I255F	probably damaging	Het
Zp2	T	A	7: 120,135,165	I554F	probably damaging	Het

Other mutations in Nuggc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01359:Nuggc	APN	14	65623207	missense	probably damaging	1.00
IGL01403:Nuggc	APN	14	65623186	missense	probably benign	0.01
IGL01413:Nuggc	APN	14	65638581	missense	probably benign	0.23
IGL02588:Nuggc	APN	14	65617777	splice site	probably benign
R0102:Nuggc	UTSW	14	65613551	missense	probably null	1.00
R0102:Nuggc	UTSW	14	65613551	missense	probably null	1.00
R0395:Nuggc	UTSW	14	65613472	nonsense	probably null
R0827:Nuggc	UTSW	14	65608891	missense	probably damaging	1.00
R1496:Nuggc	UTSW	14	65624133	missense	probably damaging	0.96
R1861:Nuggc	UTSW	14	65642001	splice site	probably benign
R1986:Nuggc	UTSW	14	65641921	missense	probably damaging	0.98
R2283:Nuggc	UTSW	14	65638612	missense	possibly damaging	0.89
R2317:Nuggc	UTSW	14	65624142	missense	possibly damaging	0.81
R3799:Nuggc	UTSW	14	65619638	missense	probably benign	0.00
R3980:Nuggc	UTSW	14	65619093	critical splice donor site	probably null
R4303:Nuggc	UTSW	14	65611172	missense	possibly damaging	0.77
R4431:Nuggc	UTSW	14	65611210	missense	probably benign	0.19
R4734:Nuggc	UTSW	14	65623230	missense	probably damaging	1.00
R5095:Nuggc	UTSW	14	65635090	nonsense	probably null
R5108:Nuggc	UTSW	14	65638680	missense	probably damaging	0.99
R5360:Nuggc	UTSW	14	65638626	missense	probably damaging	1.00
R5547:Nuggc	UTSW	14	65641881	missense	possibly damaging	0.87
R5636:Nuggc	UTSW	14	65648188	nonsense	probably null
R6494:Nuggc	UTSW	14	65648222	missense	probably damaging	1.00
R6922:Nuggc	UTSW	14	65617643	missense	probably damaging	1.00
R6971:Nuggc	UTSW	14	65608856	missense	probably benign	0.04
R7124:Nuggc	UTSW	14	65608802	missense	probably damaging	1.00
R7273:Nuggc	UTSW	14	65619608	missense	probably damaging	0.99
R7282:Nuggc	UTSW	14	65617623	missense	probably damaging	1.00
R7578:Nuggc	UTSW	14	65648174	missense	probably damaging	1.00
R7670:Nuggc	UTSW	14	65613526	missense	probably damaging	1.00
R7780:Nuggc	UTSW	14	65645041	missense	probably damaging	1.00
R7871:Nuggc	UTSW	14	65623251	missense	probably benign	0.01
R8250:Nuggc	UTSW	14	65641869	missense	probably benign	0.10
R8329:Nuggc	UTSW	14	65641282	missense	probably benign	0.01
R8334:Nuggc	UTSW	14	65645029	missense	probably benign	0.04
R8463:Nuggc	UTSW	14	65613562	missense	probably damaging	1.00
R8503:Nuggc	UTSW	14	65641348	critical splice donor site	probably null
R8737:Nuggc	UTSW	14	65645086	missense	probably benign	0.00
R8861:Nuggc	UTSW	14	65610035	critical splice donor site	probably null
R8914:Nuggc	UTSW	14	65641905	missense	probably benign
R9573:Nuggc	UTSW	14	65611154	missense	probably benign	0.37
R9666:Nuggc	UTSW	14	65619596	missense	possibly damaging	0.86
R9792:Nuggc	UTSW	14	65609896	missense	probably damaging	1.00
R9793:Nuggc	UTSW	14	65609896	missense	probably damaging	1.00
R9795:Nuggc	UTSW	14	65609896	missense	probably damaging	1.00
RF019:Nuggc	UTSW	14	65648264	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTAGGTTTCTGCTTGCAACC -3'
(R):5'- GGACAACTCCCCTGGATAGATTC -3'

Sequencing Primer
(F):5'- TGCTTGCAACCTCCGGC -3'
(R):5'- ACTCCCCTGGATAGATTCAAGTG -3'

Posted On

2014-08-25