Incidental Mutation 'R1995:Fbxo40'
ID 225704
Institutional Source Beutler Lab
Gene Symbol Fbxo40
Ensembl Gene ENSMUSG00000047746
Gene Name F-box protein 40
Synonyms 9830003A13Rik
MMRRC Submission 040005-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R1995 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36783822-36810829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36790231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 293 (D293G)
Ref Sequence ENSEMBL: ENSMUSP00000110454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075869] [ENSMUST00000114806]
AlphaFold P62932
Predicted Effect probably damaging
Transcript: ENSMUST00000075869
AA Change: D293G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075266
Gene: ENSMUSG00000047746
AA Change: D293G

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 12 104 6.1e-42 PFAM
Pfam:F-box_4 571 686 1.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114806
AA Change: D293G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110454
Gene: ENSMUSG00000047746
AA Change: D293G

DomainStartEndE-ValueType
PDB:2YRE|A 12 92 1e-27 PDB
SCOP:d1k2fa_ 62 97 5e-4 SMART
Blast:FBOX 578 616 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132511
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO40, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,678,872 (GRCm39) K145N probably damaging Het
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Btbd9 A G 17: 30,493,904 (GRCm39) Y496H possibly damaging Het
Catsperb T A 12: 101,569,026 (GRCm39) N899K possibly damaging Het
Cenpl T C 1: 160,905,994 (GRCm39) S123P probably damaging Het
Cep120 G A 18: 53,873,208 (GRCm39) T41I probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 (GRCm39) P105S possibly damaging Het
Col6a1 T C 10: 76,557,790 (GRCm39) N149D probably damaging Het
Ctnna3 T A 10: 63,656,143 (GRCm39) V241D probably damaging Het
Dcbld2 A C 16: 58,276,695 (GRCm39) E495D probably benign Het
Dmp1 T G 5: 104,357,779 (GRCm39) S40A possibly damaging Het
Dpysl4 A G 7: 138,676,686 (GRCm39) I379V probably benign Het
Eral1 C T 11: 77,965,315 (GRCm39) G367S probably benign Het
Fah C T 7: 84,251,389 (GRCm39) R31Q probably damaging Het
Fbn1 T A 2: 125,192,293 (GRCm39) probably null Het
Gemin6 A C 17: 80,535,414 (GRCm39) T125P probably damaging Het
Gpbar1 G A 1: 74,318,603 (GRCm39) G282D possibly damaging Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gucy1b1 A G 3: 81,942,160 (GRCm39) I533T probably damaging Het
H2-M9 A T 17: 36,952,678 (GRCm39) Y123N probably damaging Het
Hipk2 C A 6: 38,692,909 (GRCm39) D868Y probably damaging Het
Itprid1 T C 6: 55,945,694 (GRCm39) I805T probably benign Het
Jarid2 T C 13: 45,027,917 (GRCm39) L123P probably damaging Het
Kcnb2 C A 1: 15,779,990 (GRCm39) N287K possibly damaging Het
Kdm8 G A 7: 125,051,511 (GRCm39) G35S probably benign Het
Kirrel1 G T 3: 87,003,093 (GRCm39) A100D possibly damaging Het
Ltbp2 T G 12: 84,855,220 (GRCm39) probably null Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Neb C T 2: 52,188,744 (GRCm39) V837M probably damaging Het
Nkain2 A G 10: 32,278,347 (GRCm39) I26T possibly damaging Het
Nuggc A G 14: 65,848,623 (GRCm39) R175G probably benign Het
Or10ag57 T G 2: 87,218,175 (GRCm39) I42R probably damaging Het
Or5ac23 A G 16: 59,149,654 (GRCm39) S73P probably damaging Het
Or5d35 T A 2: 87,856,016 (GRCm39) S317T probably benign Het
Or8g52 T C 9: 39,630,709 (GRCm39) F62S probably damaging Het
Pcnt G A 10: 76,228,633 (GRCm39) Q1511* probably null Het
Piezo2 G T 18: 63,211,852 (GRCm39) T1311K probably damaging Het
Pik3c2a T C 7: 115,953,241 (GRCm39) Y1218C probably damaging Het
Pik3r4 T A 9: 105,546,364 (GRCm39) S905T probably benign Het
Pikfyve T A 1: 65,285,867 (GRCm39) D1035E probably damaging Het
Pkn3 G C 2: 29,979,989 (GRCm39) G744A probably damaging Het
Pms1 A G 1: 53,234,174 (GRCm39) S781P probably benign Het
Pogz C T 3: 94,785,255 (GRCm39) R793W probably damaging Het
Prrc2a A T 17: 35,376,405 (GRCm39) V795D probably damaging Het
Rock1 G A 18: 10,101,026 (GRCm39) R630* probably null Het
Scd4 T A 19: 44,322,617 (GRCm39) I70N possibly damaging Het
Serpine2 A G 1: 79,799,159 (GRCm39) S32P probably damaging Het
Slc9c1 A C 16: 45,374,618 (GRCm39) T328P probably damaging Het
Spata31d1b G C 13: 59,864,194 (GRCm39) L447F probably benign Het
Speer2 A G 16: 69,654,965 (GRCm39) S167P probably benign Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Tbcel C A 9: 42,362,957 (GRCm39) G29W probably damaging Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Tmem240 T A 4: 155,824,304 (GRCm39) D125E possibly damaging Het
Ttll7 G A 3: 146,667,510 (GRCm39) C792Y possibly damaging Het
Vmn1r177 T A 7: 23,565,112 (GRCm39) I255F probably damaging Het
Zp2 T A 7: 119,734,388 (GRCm39) I554F probably damaging Het
Other mutations in Fbxo40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Fbxo40 APN 16 36,790,816 (GRCm39) missense probably damaging 1.00
IGL02238:Fbxo40 APN 16 36,789,536 (GRCm39) missense possibly damaging 0.63
IGL02389:Fbxo40 APN 16 36,790,136 (GRCm39) missense probably benign 0.26
IGL02619:Fbxo40 APN 16 36,790,766 (GRCm39) missense possibly damaging 0.92
IGL02620:Fbxo40 APN 16 36,786,442 (GRCm39) missense probably benign 0.14
leuk UTSW 16 36,789,236 (GRCm39) missense probably damaging 1.00
R0532:Fbxo40 UTSW 16 36,789,984 (GRCm39) missense possibly damaging 0.92
R1016:Fbxo40 UTSW 16 36,789,539 (GRCm39) nonsense probably null
R1783:Fbxo40 UTSW 16 36,786,584 (GRCm39) missense probably damaging 0.99
R1832:Fbxo40 UTSW 16 36,789,218 (GRCm39) nonsense probably null
R1938:Fbxo40 UTSW 16 36,789,713 (GRCm39) missense probably damaging 0.98
R1974:Fbxo40 UTSW 16 36,790,303 (GRCm39) missense probably benign
R3856:Fbxo40 UTSW 16 36,789,445 (GRCm39) missense probably damaging 1.00
R4346:Fbxo40 UTSW 16 36,790,525 (GRCm39) missense probably benign 0.01
R4907:Fbxo40 UTSW 16 36,790,064 (GRCm39) missense probably benign 0.01
R5059:Fbxo40 UTSW 16 36,790,658 (GRCm39) missense possibly damaging 0.48
R5114:Fbxo40 UTSW 16 36,789,236 (GRCm39) missense probably damaging 1.00
R5361:Fbxo40 UTSW 16 36,789,914 (GRCm39) missense possibly damaging 0.62
R5721:Fbxo40 UTSW 16 36,789,296 (GRCm39) missense probably benign 0.06
R5724:Fbxo40 UTSW 16 36,790,692 (GRCm39) missense probably benign 0.18
R5808:Fbxo40 UTSW 16 36,790,744 (GRCm39) missense probably damaging 1.00
R6189:Fbxo40 UTSW 16 36,786,526 (GRCm39) missense probably benign 0.32
R6461:Fbxo40 UTSW 16 36,790,390 (GRCm39) missense probably benign 0.00
R6571:Fbxo40 UTSW 16 36,789,668 (GRCm39) missense probably damaging 1.00
R6598:Fbxo40 UTSW 16 36,789,376 (GRCm39) missense probably damaging 1.00
R6639:Fbxo40 UTSW 16 36,790,937 (GRCm39) missense probably damaging 1.00
R7017:Fbxo40 UTSW 16 36,790,732 (GRCm39) missense probably damaging 1.00
R7827:Fbxo40 UTSW 16 36,789,861 (GRCm39) missense probably damaging 1.00
R7889:Fbxo40 UTSW 16 36,790,012 (GRCm39) missense probably damaging 1.00
R8047:Fbxo40 UTSW 16 36,790,231 (GRCm39) missense probably damaging 1.00
R8293:Fbxo40 UTSW 16 36,790,387 (GRCm39) missense probably benign
R8297:Fbxo40 UTSW 16 36,789,670 (GRCm39) missense probably damaging 0.98
R8397:Fbxo40 UTSW 16 36,790,985 (GRCm39) missense probably damaging 1.00
R8423:Fbxo40 UTSW 16 36,790,947 (GRCm39) missense probably damaging 1.00
R8515:Fbxo40 UTSW 16 36,791,015 (GRCm39) missense probably damaging 1.00
R9064:Fbxo40 UTSW 16 36,791,002 (GRCm39) missense probably damaging 0.99
R9088:Fbxo40 UTSW 16 36,790,150 (GRCm39) missense
R9119:Fbxo40 UTSW 16 36,786,457 (GRCm39) missense probably damaging 0.99
R9278:Fbxo40 UTSW 16 36,789,940 (GRCm39) missense possibly damaging 0.94
R9339:Fbxo40 UTSW 16 36,789,286 (GRCm39) missense probably damaging 1.00
X0022:Fbxo40 UTSW 16 36,789,663 (GRCm39) missense probably benign 0.37
Z1176:Fbxo40 UTSW 16 36,789,961 (GRCm39) missense probably damaging 1.00
Z1177:Fbxo40 UTSW 16 36,790,624 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGCTCACGGGAATCTTGAAGG -3'
(R):5'- CTGGACAAGTTTGGCAAGTG -3'

Sequencing Primer
(F):5'- CTCACGGGAATCTTGAAGGTATAAAC -3'
(R):5'- GCACGCAGCCTCTGTTTTAACAG -3'
Posted On 2014-08-25